SGN Marker CT88

SGN-M131

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT88 image not available
Forward sequence
TTTTTTTTTTTTTTTTGTAGTTTAGAAGTGGCATAAAGTTGGGCCGAAGAGCTAGGAAGAGTAAGCATGTCAAGTGATAGTTGCAGCCAC
TGGTGTTATAGTTGTAGACAACCCGTGAATCTCAGGAGACAAAATGATGTTTGCCCCAATTGCGGTGGTGGATTTGTTCAAGAGCTTGAA
GACATAACGAGTAGTAGTGTAGATAATCAGACCCAGAGGCCGAGATTCATGGAATCCGTCTCAAACTTTTTAAGACGACAAATCTCAGCT
ACAAGTAATACTTCTGAGAGAGGGAGATCTGATGGGGGTGCTGAACGAGGAAATTTGTGGAATCCGTTGCTGATTTTCAGTGGTGATACG
CCTGTTCATATGCCTGGGGATGGTGGAGTTT
Reverse sequence
TTCTGTTGTAGCCATGGCGTGATACAATCCGAGTGATATAAGTGCTTGCAAGGCAATTTTGTTGCCTTAGTCCCCAGAGCAAATTTCTCC
TTACAAACAGGGCAGTGCGAATCCGATCTAACATCCTTTTTTGATATCTTGACTGTTGGTAGGGAATCAATTGAACATCTCGAGACAGGA
GGAGGAGCACCACGCTGATTTCTATTTACAATTTCTTCAAAAAATTCCTCCACTCCTGGACCAACAAAATAATCACCACCATTTTCTTGT
CGGAATCCAAGTGCCTCATTAAGAAACTCCAAAACTCCACCATCCCCAGGCATATGAACAGGCGTATCACCACTGAAAATCAGCAACGGA
TTCCACAAATTTCCTCGTTCAGCACCCCCATCAGATCTCCCTCTCTCAGAAGTATTACTTGTAGCTGAGATTTGTCGTCTTAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1673781e-167332 (84.9% of RFLP seq)+
SGN-U1673781.3e-4799 (22.3% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51908)
Chromosome
8
Position
86.45 cM
Confidence
uncalculated
Protocol
unknown
Subscript
C

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42363)
Chromosome
8
Position
70.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39078)
Chromosome
8
Position
43.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8230)
Chromosome
8
Position
37.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8232)
Chromosome
8
Position
55.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8231)
Chromosome
8
Position
47.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT88 was used as an overgo probe on plate 1 [well B7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAATCAGACCCAGAGGCCGAGATT
B sequence
TGAGACGGATTCCATGAATCTCGG
AB sequence
TAATCAGACCCAGAGGCCGAGATTCATGGA
Marker sequence
TTTTTTTTTTTTTTTTGTAGTTTAGAAGTGGCATAAAGTTGGGCCGAAGA
GCTAGGAAGAGTAAGCATGTCAAGTGATAGTTGCAGCCACTGGTGTTATA
GTTGTAGACAACCCGTGAATCTCAGGAGACAAAATGATGTTTGCCCCAAT
TGCGGTGGTGGATTTGTTCAAGAGCTTGAAGACATAACGAGTAGTAGTGT
AGATAATCAGACCCAGAGGCCGAGATTCATGGAATCCGTCTCAAACTTTT
TAAGACGACAAATCTCAGCTACAAGTAATACTTCTGAGAGAGGGAGATCT
GATGGGGGTGCTGAACGAGGAAATTTGTGGAATCCGTTGCTGATTTTCAG
TGGTGATACGCCTGTTCATATGCCTGGGGATGGTGGAGTTT
Genomic location of CT88  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D131 marker 131
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)