Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TM34

SGN-M1310

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40167)
Chromosome
2
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM34 was used as an overgo probe on plate 12 [well F6]

Plausible BAC Matches:   P244M08,   P001N23,   P303E20,   P180A05,   P204D01,   P017B10,   P216M11,   P048A06,   P057O20,   P101D04,   P061L05,   P120K01,   P330B11

 Overgo Sequences

A sequence
GTTCGCTCCACCTTTATGTCTTGC
B sequence
AACGCCAGTTAACGGAGCAAGACA
AB sequence
GTTCGCTCCACCTTTATGTCTTGCTCCGTT
Marker sequence
ANNNGAATACCCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT
GGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGTGAAGATGGA
GATGATGAGTCTGAACAAGTTTATGCAGAGATACCCTCCCTCTCCGAATC
CGTAGCAAAGCTCCGGTAGGTATTCAAAAGCTTATTACGAGTTTCATAGA
CGTATGCCTCCAGGGTGTTTTTCTTGTCTTTAGTTCGCTCCACCTTTATG
TCTTGCTCCGTTAACTGGCGTTCCTTTTCCTTAGCTTGGGATAGCTCCAT
GAGGGTCATTCCACCATCAACACTTCCACTGACAGGAATATCCTGTCTCT
TAACGGCCTTACTTTTCCTTGTATCATCTCCCTCCATATTTTCTGCATAA
GTATCAATATTATTTTCCGACGTAGAATGACTTGATTGATCTTTGATCAG
CCAAGCCGATTCTACTGTAACAACACCATGGAGGTTTAATTGAATTTTGA
CTTTGACCTTTGCTTTTTCCTTCCACACAGGCTTAATCCTCAATCATCAT
ACTAGTTTACATTTAGATATATCTATTTTTGTAATCTAAATGAATTCATA
ACTTGTTGAATGTAGAAATTTGGTGTTATGTGCAAAAAAAAAAAAAAAAA
AAAAAA
Genomic location of TM34  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1310 marker 1310
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)