SGN Marker TM12

SGN-M1312

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40144)
Chromosome
6
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM12 was used as an overgo probe on plate 3 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACCCTCACTAAAGGGAACAAAAGC
B sequence
CCGCGGTGGAGCTCCAGCTTTTGT
AB sequence
ACCCTCACTAAAGGGAACAAAAGCTGGAGC
Marker sequence
TCGNNNTACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGG
CGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGGNNAATACATCN
ANACCCCGTNTANATATATNAAGGNTGTTGNGACTGCATTATGATCTNNA
NGGNACANGAGGGNATNGATNNNACACAGTNNANANCTNACCTGAGGNCC
TCATTACNTNCTTCAGNTTNGGGGGCACAACNTNCCAAATCAACGGAGTA
NNNCCAGTTGNTNCGGGTTGTGGGATCATCATNTGGATTGGAACAACCNC
NATTAGCCATNTNNCNGNNCCCTGATCNTGCAGAAATAANNGGAACATCA
TGCTGGAANGGGTTCTNNNAANTNTNCACATCTACCNTNCNGNGATTAAT
GATCATGGGACCTNNNAGAANNNANCNTNCANTATNNACGGGNANNAACA
TNTTGNGACCTATATTGNACCCAGAAATGAAGCCAAATTGCTGTCNTGAG
AGANACACANANANNACCNGGTNCNTAAAAGGGGTNNANCATTGNANATA
TTGGNNATNNAAAGAGCATNGATTGGNCACTC
Genomic location of TM12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1312 marker 1312
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)