SGN Marker P27

SGN-M1317

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C22704
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39130)
Chromosome
6
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P27 was used as an overgo probe on plate 14 [well D3]

Plausible BAC Matches:   P294F07,   P026E06,   P072G13

 Non-Plausible BAC matches

P018A13,   P010D07,   P017F18,   P294H15,   P114G08,   P313A09,   P308M12,   P107O24

 Overgo Sequences

A sequence
CAAGAAGGCAACTGCTGAAACCTC
B sequence
AGTGGTGCAAGCATTAGAGGTTTC
AB sequence
CAAGAAGGCAACTGCTGAAACCTCTAATGC
Marker sequence
GCACGAGCTTTGGAAGTTGTGTGAGTTTTCAGAAAGCCTTTGAAGTTCGC
CGGAAAATAGCAATATTTTCAATTCAAGCCAATCAGATGGGAAGAGGAAA
GATAGAGATAAAGAGGATAGAGAACAACACAAACAGGCAGGTTACATTTT
GCAAGAGAAGAAATGGATTGTTGAAGAAAGCCTATGAACTCTCTGTTCTA
TGTGAAGCTGAGATTGCTCTTATTGTTTTCTCCACACGTGGACGCGTCTA
TGAATACTCTAACAACAACATTAAGGCAACTATTGAACGATACAAGAAGG
CAACTGCTGAAACCTCTAATGCTTGCACCACTCAAGAGCTCAATGCTCAG
TTTTATCAACAAGAATCAAAAAAGCTGCGCCAACAGATACAAATGATGCA
GAATTCAAACAGGCATCTGGTTGGTGAAAGATTAAGTTGTTTGAACGTAA
GAGAGCTGAAGCAGTTGGAAAATATACTTGAACGAGGCATCAGCAGAATC
AGATCAAAAAAGCATGAGATGATACTGGCTGAAACTGAGAATTTGCAGAA
GAGGGAAATTCTACTGGAACAGGAGAATGCATTCCTTAGATCAAAGATAG
CAGAAAATGAGAGGCTTC
Genomic location of P27  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1317 marker 1317
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)