SGN Marker P39

SGN-M1319

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C16828
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39132)
Chromosome
11
Position
33.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P39 was used as an overgo probe on plate 10 [well B7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TACCTTACTCAGGCTGAAGAGATC
B sequence
GCCACACCTTGCTTTTGATCTCTT
AB sequence
TACCTTACTCAGGCTGAAGAGATCAAAAGC
Marker sequence
TTGGATCAACCATCACTTTAACTTCAGCTTGTAGAAAATAGCAACTACTC
CAGATTAAGCAAGGAAATTTCCGAAAAAAGTCATCGATTAAGGCAAATGA
GGGGAGAAGAACTTCAAGGACTAAATATTGAAGAGTTGCAACAATTGGAG
AGATCTCTTGAAACTGGATTGAGCCGCGTCATAGAGAGAAAGGGTGATAA
AATAATGAGAGAGATCAACCAACTCCAACAAAAGGGTATGCATCTAATGG
AAGAAAATGAAAAATTAAGGCAACAGGTGATGGAGATATCTAATAATAAT
AATAATAATAATAATGGATATAGAGAGGCAGGAGTAGTAATATTTGAACC
AGAAAATGGATTTAATAATAATAATAATGAAGATGGCCAATCATCTGAAT
CAGTAACAAATCCATGTAACTCAATTGATCCTCCTCCTCAAGATGATGAT
AGTTCTGATACTTCTCTCAAATTGGGGCTACCTTACTCAGGCTGAAGAGA
TCAAAAGCAAGGTGTGGCTATTTTTGTATGTTATTAGAAGAAGGAGAAAA
AAAAAAGTAACTACTAATTATTATAATTAATTAATGTCTGATTAATGTAA
AAGCTAACCCCAAAAATTTCATATTATGGATGTAATTGGTGTATTAATCT
CATGTATTCGTCTCCCATTAGTT
Genomic location of P39  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1319 marker 1319
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)