Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG242

SGN-M132

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG242 image not available
Forward sequence
TCCTCTGCCTTTTTTGTTATCTGAAGAGATTTGCCGTCCCCCTTCGCAAAACCACCTCTTTGCCAAACTCCTATAACATAGAAAAAACAA
CAAAGACCAGCTACAATAAATATTGATGCAGGGCCTCTGCTTCTTTTATCTCCTGGATTTCCTTTTATCGCCATGATTGACCTAGAATTG
TTCATCCAGATTTCAGATGACATGGAAACAATGAAAGAAGATAATGCTCATTGTCATGAATAGTAATCGTTGAGGATGTAGGTGAAGAGG
CTATTGACTACCCTCATATTAAAAAACATATTTTAGTTTGAGAAATATGATCAAGTGTTAAGTAACTATCATAGGCTCTTGTTACTCTAA
TTATGCAAGCACTTACATAAAGACGACAAAAGAGGGG
Reverse sequence
AAGGGAATTCTCTTCAGACCAGCAGAGGGAAAGGAAGCAACCCGCATCAAACCTAACCCAAACCTAAAGGTACAACCTGTCTTTGTGGAT
CCAGGTCCCAGGAAAACCCCCAAGGAGAAGAATAATAAGAAAGGCCCGAGAAATGGCTTGTGCTTGGAGATTACTGGGAGAGTGCAACAT
GATACCAGTGAACACTCACGTTTGATCGTAGAGGGCAAGCTACATGGATCTTCAAGTAGCAAAATCGTGGCATGAGCCATCTATTAATAG
TACAGTCGGAACTTCAGATGACTCTTAAGTGTAAACCTTTGATTACTATTGAGAAGTATATAGCTTGACCAATTGAGTACTCACACCTCC
AAACATGTCATCTTTCTGGGGTAGTGTAGAAAGTTGCTCTTATTAACTTGCTATTTTAAGTTCTGATTTATCAAGAAAACAATTCTCTGC
AAATATTTGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1676772.8e-0528 (7.1% of RFLP seq)+
SGN-U1703127.6e-1295 (23.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53232)
Chromosome
3
Position
74.20 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8236)
Chromosome
3
Position
92.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8238)
Chromosome
3
Position
42.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8237)
Chromosome
3
Position
100.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG242 was used as an overgo probe on plate 2 [well G2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTTGCCGTCCCCCTTCGCAAAAC
B sequence
GTTTGGCAAAGAGGTGGTTTTGCG
AB sequence
ATTTGCCGTCCCCCTTCGCAAAACCACCTC
Marker sequence
TCCTCTGCCTTTTTTGTTATCTGAAGAGATTTGCCGTCCCCCTTCGCAAA
ACCACCTCTTTGCCAAACTCCTATAACATAGAAAAAACAACAAAGACCAG
CTACAATAAATATTGATGCAGGGCCTCTGCTTCTTTTATCTCCTGGATTT
CCTTTTATCGCCATGATTGACCTAGAATTGTTCATCCAGATTTCAGATGA
CATGGAAACAATGAAAGAAGATAATGCTCATTGTCATGAATAGTAATCGT
TGAGGATGTAGGTGAAGAGGCTATTGACTACCCTCATATTAAAAAACATA
TTTTAGTTTGAGAAATATGATCAAGTGTTAAGTAACTATCATAGGCTCTT
GTTACTCTAATTATGCAAGCACTTACATAAAGACGACAAAAGAGGGG
Genomic location of TG242  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D132 marker 132
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)