SGN Marker P40

SGN-M1320

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C22017
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39133)
Chromosome
5
Position
67.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P40 was used as an overgo probe on plate 12 [well A5]

Plausible BAC Matches:   P241M05,   P208I18,   P118K05,   P221L22,   P302D09,   P266C20,   P277D14,   P263F09,   P015M08,   P165E14,   P208O04,   P194O07,   P073D14,   P164H06,   P289J16,   P318H03,   P067N08,   P048I16,   P269I01

 Overgo Sequences

A sequence
AAGACGTTGGAGAGGTACCAGAAG
B sequence
GTGCTCCATAGTTGCACTTCTGGT
AB sequence
AAGACGTTGGAGAGGTACCAGAAGTGCAAC
Marker sequence
TAGAGAACAAGATCAACAGGCAAGTGACCTTTGCTAAGAGAAGAAATGGG
CTTTTGAAGAAAGCTTATGAGCTTTCAGTTCTTTGTGATGCTGAGGTTGC
TCTAATCATCTTCTCTAATAGGGGAAAACTCTATGAGTTCTGCAGTAGTT
CTAGCATGCTAAAGACGTTGGAGAGGTACCAGAAGTGCAACTATGGAGCA
CCTGAACCGAATATATCAACACGAGAAGCACTGGAAATTAGTAGCCAGCA
GGAGTACTTGAAGCTTAAAGGACGTTACGAAGCATTGCAGCGATCACAGA
GGAATCTTCTTGGTGAAGATCTTGGTCCTTTGAACAGCAAAGAACTTGAA
TCACTTGAGAGACAACTTGATATGTCGCTCAAACAGATCAGATCAACTCG
GACTCAGTTAATGTTGGATCAACTTACAGATTATCAGAGAAAGGAACATG
CATTGAACGAAGCCAACAGAACCTTGAAACAAAGGTTGATGGAAGGAAGC
CAACTAAATCTGCAGTGGCAGCCAAATGCACAAGATGTGGGCTATGGCCG
GCAAACAACTCAAACTCAGGGCGATGGCTTCTTTCATCCTTTGGATTGTG
AACCTACTTTGCAAATTGGGTATCAGAATGATCCAATTACAGTA
Genomic location of P40  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1320 marker 1320
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)