SGN Marker P41

SGN-M1321

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C7531
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39134)
Chromosome
4
Position
88.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P41 was used as an overgo probe on plate 7 [well A9]

Plausible BAC Matches:   P105L22

 Overgo Sequences

A sequence
TAATTCGACGAGCAGGCAAGTGAC
B sequence
TTTCCTCTTCGAGAACGTCACTTG
AB sequence
TAATTCGACGAGCAGGCAAGTGACGTTCTC
Marker sequence
CAGACTGAACCCAAAACGACGATTGCGAAGTCTTCTTTTGTCTTCTCCAT
CAACAGCAACTTTTTTGCCCCTCTCTCTCTCGATCGAAAAATTCCTCCAT
TGATTTGTTCTTCTGCTTCTTCTCGTGAATGAAATTTCTCTGAGAGAGGA
AGTAGAGAGAGAGAGAGAGAGTGAGTGTGTGTGTGTGAGAGAGATCGGCG
ATGGGGAGAGGTAAGATAGTGATAAGGAGGATCGATAATTCGACGAGCAG
GCAAGTGACGTTCTCGAAGAGGAAAAATGGATTGTTGAAGAAGGCGAAGG
AGCTAGCGATTCTGTGCGATGCGGAGGCCGGAGTTATTATCTTCTCCAGT
ACTGGAAAACTCTATGAATATTCAAACACCAGCATGAAGTC
Genomic location of P41  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1321 marker 1321
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)