Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker P45

SGN-M1322

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C68948
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39135)
Chromosome
6
Position
52.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P45 was used as an overgo probe on plate 14 [well F5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCGTCAAGTTACCTTCTCGAAACG
B sequence
CAGCAAACCAGATCGACGTTTCGA
AB sequence
CCGTCAAGTTACCTTCTCGAAACGTCGATC
Marker sequence
AAGAGGAAGAGTCCAGTTGAAGCGAATAGAGAACAAAATTAACCGTCAAG
TTACCTTCTCGAAACGTCGATCTGGTTTGCTGAAGAAAGCCCATGAGATC
TCTGTGCTTTGTGATGCTGAGGTTGGTTTGATTGTTTTTTCTACTAAAGG
AAAACTCTTTGAATATGCCAACGATTCCTGCATGGAGAGGATACTTGAAA
GATATGAAAGATACTCATTTGCTGAGAAACAGCTTGTTCCTACTGATCAT
ACCTCCCCGGTAAGCTGGACCCTTGAACATGCAAAACTTAAGGCCAGACT
TGAGGTTCTGCAGAGGAACCAAAAGCATTATGTGGGAGAAGATTTGGAGT
CCTTAAGTATGAAGGAACTTCAGAATCTGGAGCACCAGCTTGATTCAGCT
CTTAAACACATTCGATCAAGAAAGAATCAATTGATGCATGAGTCCATTTC
TGTGCTTCAAAAAAAGGACAGAGCATTGCAGGAGCAAAACAACCAGCTTT
CGAAGAA
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of P45  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1322 marker 1322
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)