SGN Marker P50

SGN-M1325

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C15929
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39138)
Chromosome
3
Position
30.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P50 was used as an overgo probe on plate 16 [well H12]

Plausible BAC Matches:   P253N18,   P137K15

 Overgo Sequences

A sequence
AGGACGTGCAAGAGAAACAACGAC
B sequence
AGTGCTTTTGTCCACCGTCGTTGT
AB sequence
AGGACGTGCAAGAGAAACAACGACGGTGGA
Marker sequence
CCCGGAAAATCGGAATTTAAATGGTGAGAGGAAAAGTAGAAATGAAAAGA
ATAGAAAATTCAACGAGCAGGCAAGTGACGTTTTCGAAAAGACGAAATGG
ACTTACGAAGAAAGCTTATGAATTATCAGTTCTTTGTGATGCTGAAGTTG
CTTTCATTATTTTCTCACATAAAGGAAGACTTTATGAATTTGCTAGCTCC
AACATGCAGAAGATAATTGAGAGATACCGAGGACGTGCAAGAGAAACAAC
GACGGTGGACAAAAGCACTGAACTCGAGCACTACATGGAGAACTTGAAGC
ATGAAACAGCTAATATGGCGAAGAAGATAGAGATCCTCGAAATTTCTAAA
CGGAAGCTAATGGGGCAAGGATTAGGGTCATGTTCAATGGATGAACTAGA
AGACATTGACAGCCAACTGGAGAGGACCCTCAAAATTATCAGGGCTAGAA
AGACTCAATTGTTCAAAGAGGAAATAGAAAGTCTAAAAGCAAAGGAGAGA
CTATTGCTCCAACAAAATGCAAGTTTACGTGAAAAG
Genomic location of P50  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1325 marker 1325
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)