SGN Marker P54

SGN-M1327

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C18347
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39140)
Chromosome
11
Position
52.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P54 was used as an overgo probe on plate 10 [well H4]

Plausible BAC Matches:   P156G05,   P281L16,   P212N16,   P306E12,   P069J01

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACTCAGATCGATCGATTCGATCG
B sequence
TCTTTCCTCGACCCATCGATCGAA
AB sequence
CACTCAGATCGATCGATTCGATCGATGGGT
Marker sequence
GCATATCTTATCCATTCAACTCACTCAGATCGATCGATTCGATCGATGGG
TCGAGGAAAGATAGAGATAAAGAGGATTGAAAACAACACAAATCGACAGG
TAACATTCTGCAAGAGAAGAAATGGATTACTGAAAAAGGCATATGAACTT
TCAGTTCTATGTGATGCTGAGATTGCTCTCATTGTTATCTCTACTCGTGG
TCGACTCTATGAATACTCTAACAACAATGTAAAGGCAACTATAGAACGAT
ACAAAAAGGCAACAGCAGAAACGTCTAGTGCGTACACTACTCAAGAGCTC
AATGCACAGTTTTACCAACATGAATCAAAGAAGGTGCGGCAACAGATACA
AATGATGCAGAACACAAATAGGCATCTGGTGGGTGAAGGGCTGAGCTCTT
TGAATGTGAGGGAACTGAAGCAATTTGAGAACAGACTTGAACGACGCATT
ACAA
Genomic location of P54  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1327 marker 1327
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)