SGN Marker TG244

SGN-M133

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
725
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATTTTATCAGGACTCAAGAAGTTGGTGAATTTTTCAGCGGGGCTTTGGCTGGGGCGATGACTAAGGCCATTCTAGCTCCTCTTGAAACCA
TCAGGTTGGTTACAACGTGTTTATAAGTGCATTGATTTTTTTTTTTTTTAAAAAAAAAAATTACATCGGCATAAAAAGAAAAGGGGGAAA
ATCTTACGGCGTTAGAGCGCTAAATATTAACTTATGTTAACAAATTGCTGCATTTGTTACAGCTTGGTTTGAAAGGTATCACATAATTTT
AAAGACAGGCCTATTCGTTTGCTATATTTTTGGCCCATGCAGTCTTTTATAAATGATGCAACTACTTTGGGGGGCATGCTTTATCTCCAT
GGGGGATCTTCTGTAGCACTCTCATAGGGTTACTGTTCATCTATATAGAAGCTACCTTATGTTACTTTTTTTTTAAAAAAAATAAATAAA
TAAATAAAATATTTC
Reverse sequence
CTTGGGGCTACCAGTATCCGTCCATTTCTCTTGTGCTGAAGTCATTGCTCGCTTGACACACTCAAATGTCCCAAGTTCAATTGCTTGTGT
GGGAATTATCCGTAGCATGTTAATTGTATTACCTGCCCACAGCCCTTGCCAACCCTGCTGTTCAATAACCTGAATAAAACTTGTACCAAT
GTTTCTGGACCCAACACCAACTACCATTCTTGTCCTGCATATTTTAAATACCAAAATTAGGTAACATAACCAAATGAATAGTAAGCCAAT
TTAAAGCAAATAAAAATTCCTGCAAGTCAATTCATATCCTATATGAGGAGCTTCACTGACAGATATATTTTATTTATTTATTTATTTTTT
TTAAAAAAAAAGTAACATAAGGTAGCTACTATATAGATGAACAGTAACACTATGAGAGTGCTACAGAAGATCACACATGGAGATAAAGCA
TGCCCACCAAAGTAGTTGCATCATTTATAAAAGACTGCATGGACCAAAAAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1595611.4e-4795 (20.4% of RFLP seq)+
SGN-U1689036e-115208 (41.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53233)
Chromosome
3
Position
94.82 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50357)
Chromosome
3
Position
64.73 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48291)
Chromosome
3
Position
137.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39957)
Chromosome
3
Position
171.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8239)
Chromosome
3
Position
110.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8240)
Chromosome
3
Position
127.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8244)
Chromosome
3
Position
63.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35624
Forward primer (5'-3')
GCGATGACTAAGGCCATTCT
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 200+250
Solanum lycopersicum LA925: 125+325
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATAAAGCATGCCCACCAAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 55
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 200+250
Solanum lycopersicum LA925: 125+325
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG244 was used as an overgo probe on plate 2 [well H9]

Plausible BAC Matches:   P170I08,   P252A24,   P115J13,   P119L23,   P207P11,   P030O03,   P262F12

 Overgo Sequences

A sequence
CGATGACTAAGGCCATTCTAGCTC
B sequence
CTGATGGTTTCAAGAGGAGCTAGA
AB sequence
CGATGACTAAGGCCATTCTAGCTCCTCTTG
Marker sequence
ATTTTATCAGGACTCAAGAAGTTGGTGAATTTTTCAGCGGGGCTTTGGCT
GGGGCGATGACTAAGGCCATTCTAGCTCCTCTTGAAACCATCAGGTTGGT
TACAACGTGTTTATAAGTGCATTGATTTTTTTTTTTTTTAAAAAAAAAAA
TTACATCGGCATAAAAAGAAAAGGGGGAAAATCTTACGGCGTTAGAGCGC
TAAATATTAACTTATGTTAACAAATTGCTGCATTTGTTACAGCTTGGTTT
GAAAGGTATCACATAATTTTAAAGACAGGCCTATTCGTTTGCTATATTTT
TGGCCCATGCAGTCTTTTATAAATGATGCAACTACTTTGGGGGGCATGCT
TTATCTCCATGGGGGATCTTCTGTAGCACTCTCATAGGGTTACTGTTCAT
CTATATAGAAGCTACCTTATGTTACTTTTTTTTTAAAAAAAATAAATAAA
TAAATAAAATATTTC
Genomic location of TG244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D133 marker 133
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)