SGN Marker P61

SGN-M1331

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C93659
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39143)
Chromosome
2
Position
111.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P61 was used as an overgo probe on plate 11 [well D7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TAGAGGATGGGAAGAGGTAGGGTA
B sequence
CGATCCGTTTCAACTCTACCCTAC
AB sequence
TAGAGGATGGGAAGAGGTAGGGTAGAGTTG
Marker sequence
GTCTCTATCTATGCTAGGTAGCTTATATGATTTAATAGTTCGATTAATTT
AAATACGCATTAAAGATAGAGGATGGGAAGAGGTAGGGTAGAGTTGAAAC
GGATCGAGAACAAAATAAGCAGACAAGTAACATTCTCAAAGAGACGATCT
GGATTATTGAAGAAAGCTAATGAGATCTCAGTATTATGTGATGCTGATGT
TGCATTGATTGTGTTTTCTACCAAAGGCAAACTTTTCGAGTATTCCTCAA
ATGACTCAAGTATGGAAAGTATTCTTGAAAGATATGAAAGATGCTCATAT
GCAGAGAGACAGATGAATGCTAATGATTCTGATCCCAAGGAAAATTGGAG
TGTGGAGTATCCGAAGCTCATGTCAAGAATTGAACTTTTACAAAGAAATA
TAAGGCATTACATGGGTCAGGATCTGGACCCTCTCAGTTTGCGTGAGCTC
CAGAGTATAGAGCAACAGATTGATACTTCATTAAAGAGAATTAGAAGCAG
GAAGAATCAACTGATGCACGAGTCCATTTCTGAGCTGCAGAAAAAGGAGA
AAGCGCTCCAAGAACAAAACAACTTGATTACTAAGAA
Genomic location of P61  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1331 marker 1331
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)