SGN Marker P62

SGN-M1332

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C23579
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39144)
Chromosome
12
Position
57.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P62 was used as an overgo probe on plate 5 [well G6]

Plausible BAC Matches:   P047D08,   P122K22,   P146E19,   P104O23,   P065H06,   P235H23,   P062H18,   P001G05,   P053C22,   P090I09,   P052M24,   P162M21,   P185A03,   P159L23,   P092H01,   P138P04,   P195I23

 Overgo Sequences

A sequence
GTTGCTCTCATCATCTTCTCTAGC
B sequence
CATAGAGTTTTCCGCGGCTAGAGA
AB sequence
GTTGCTCTCATCATCTTCTCTAGCCGCGGA
Marker sequence
TGGGAAGAGGAAGAGTAGAACTAAAGAGAATAGAGAACAAAATAAACAGG
CAAGTTACTTTTGCTAAGAGAAGAAATGGACTTCTTAAGAAAGCTTATGA
GTTATCTATACTTTGTGATGCTGAAGTTGCTCTCATCATCTTCTCTAGCC
GCGGAAAACTCTATGAGTTTTCAAGTGCTTCCAGCATGATGACAACACTT
GAAAAGTATCAACAATGCAGTTACGCATCTTTGGACCCGATGTTACCGGT
TAGTGATACTCAGATGAACTACAATGAGTATGTGAGGCTAAAAGCTAGAG
TTGAGCTCCTTCAACGTTCTCAAAGACATATTCTTGGAGAGGATTTGGGC
ACACTAAACTCGAAAGAACTTGAGCAGCTTGAGCACCAATTGGATGCATC
TTTGAAGAAAGTTAGATCAAAAAAGACTCAATCTATGCTGGATCAGCTGG
CAGACCTTCAAGAAAAGGAGCAAATGCTGGAAGAAGCAAATAAACAACTA
AAAAACAAGCTTGGAAGAAAGTGCAGCTAGAATTCCACTTGGATTGTCAT
GGGGAAATAATGGAGGACAAACAATGGAATACAATCGACTCCCTCCACAA
ACTACTGCACAACC
Genomic location of P62  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1332 marker 1332
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)