SGN Marker P68

SGN-M1337

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C91178
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49358)
Chromosome
12
Position
47.77 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47293)
Chromosome
12
Position
68.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39151)
Chromosome
12
Position
70.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P68 was used as an overgo probe on plate 4 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGAAGGACGTCTAATACGTTAAG
B sequence
TTCGCGAAAAAATGCCCTTAACGT
AB sequence
CTGAAGGACGTCTAATACGTTAAGGGCATT
Marker sequence
AGAAATCAATGCTCTTCATTTTTTTCCCCCTTTTTCTAAACTAGGGTTTC
TATAACAACAACTATTTGTGTCTTCACTCTATTATAATTTAACTTATAAA
GTTTTTTCTAATTTCTTTTTCTCTTCATCTTTCAGATCTAAGAAACCATA
AAGTTTTTATTTTTAGGGGTTATTATCCACTTCAAGATTTAGAATCTTTC
TATTTTTGGAAACTTCTCATGAATTGGTGGAAAGAGGATATTTCTGAAGG
ACGTCTAATACGTTAAGGGCATTTTTTCGCGAAGAAGAAAATGGTGAGGG
GAATAACTGAGATGAAAAGGATTGAAAATACAACAAGTAGACAAGTGACA
TTCTCAAAAAGAAGAGGTGGACTACTTAAGAAGGCATTTGAACTCTCAGT
TCTTTGTGATGCTGAAGTTAGTCTCATCATATTTTCTCAAAAAGGAAAAC
TTTTTGAGTTTTCAAGTTCAAGTACTAACAAGACAATAGAACGTTATCAA
AAGAATGACAAGAATTTGGGTCATGAAAATATATTACTTGAACAAACTAC
AAAGCATTTGAA
Genomic location of P68  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1337 marker 1337
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)