SGN Marker P74

SGN-M1343

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C2403
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39153)
Chromosome
4
Position
70.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P74 was used as an overgo probe on plate 7 [well B7]

Plausible BAC Matches:   P181H15,   P282D22,   P286O03,   P171B19,   P052J18,   P118A18,   P021C10,   P014I04,   P216F16,   P112L07,   P305E11

 Overgo Sequences

A sequence
GGTACCTTACCGGAAAATCAGAGG
B sequence
ACCGCCGGTTTTTGTTCCTCTGAT
AB sequence
GGTACCTTACCGGAAAATCAGAGGAACAAA
Marker sequence
ACCTTTTCCTCCCACCATGAATATTAATAACAATACCAACTCCGCCGCCA
ACTCCGCCGCCGTCGCCGTCAAGAAAACTCAAGGGCGGAGGAAAATAGCA
ATTAAACCAATAGCAAATCAAAACAGTAGGCACGTTACCTTTAGCAAACG
CCGTTTAGGTCTCTTCAAAAAAGCTAGCGAACTTTGCATTTTAACCGGCG
CTGAAATCGCTATTATGGTTCAGTCGCTAAAACGACAGCGTTTGTTCACT
TTTGGTCATCCGAGCGCCGACGCCGTCATTAACCGGTACCTTACCGGAAA
ATCAGAGGAACAAAAACCGGCGGTCGATGATCAGTTGAACTATGTGCAAC
AGAGCAATGAATATTATTCTCAGATCTGTAGAGAATTGGAGTTGGAGAAG
AAGGTAAGGAGGAGATTGTTATTGATGAATCGAAAAT
Genomic location of P74  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1343 marker 1343
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)