SGN Marker TG245

SGN-M135

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAATGATGGTTGAGACTATAATAACTTCATCTGTTTCTAAGAAACTCTACTTTAATGCTGTGTTTTCATGGTATGTACACATTGCAGGTT
AACATACCTGCTGCTTATCTTAGTTCCAACATGGAGTGGACTGAGCAACAGGAGATACTTAGAGAGCTCAATTCAGATGGTTGCAAATAC
AAATTTTTATATGTTACCCCAGAGAAAGTTGCCAAGTGCGTACTCGTAATTTCATTTGGTAACATTTGAAACTTATGGTAACTTCTCTGA
ATGAAGTGTCTGATATTTAAGAGTAAAGACAAATCTTGAAGTTCCTTGTCACTTCCTTATTCCTTGGCTGATCTGTTATTCTGGTGCAAC
TATGAAATAGTGAGATGCTAGCAGGAAAAATAAGTTCCTTACTGGAGGCATGAAAGCTTTCTGAAGGTGTGATGGATAAGCTCCTATTAA
TGAAC
Reverse sequence
CTTTTCTGCTACTCTCTCACAATCCATTCTAGAAAGACAATAAATTATCCCGCATTGATCAAAATGATTATTCTTTATAAAAGTGCCAAT
GTCTTCCAAACACTTCTTTGTCTTTGGGATAACAGTATATCTGCAAATGATGAAAAGTTCCACAATCATGTATTTGTAAGGCCAAAAAAG
GTATGGTACCACTACACTTTCAGAATCATTTATTCACCTTAAATTTGGGCGATTGAAGCTTTGTCGGAAAATAATGCAGTTGGCAAGACC
AAGAGCCTGAACAACATCCTCCTTGACACTTATTGTAGCAGTAGCAGTCAAGGCCAGAACAGGCACAGTTGGGAACTTTTGCTTCAGGAT
ACCTAAACACTGGATGACAACTGAAAAGTTTAGCGTCCATCAAAAGTACCCCAACAAATATGATAACACAAAAAATGCTCGAAAAAGACA
TTACCTGATAATCAGGCCTGAAATCATGTCCCCACTGGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50358)
Chromosome
1
Position
84.20 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48292)
Chromosome
1
Position
122.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43592)
Chromosome
1
Position
90.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43309)
Chromosome
1
Position
110.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39958)
Chromosome
1
Position
133.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8250)
Chromosome
1
Position
98.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8254)
Chromosome
1
Position
128.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG245 was used as an overgo probe on plate 5 [well D5]

Plausible BAC Matches:   P044E20,   P057J16

 Non-Plausible BAC matches

P302I06,   P014O17,   P033D18,   P168C11

 Overgo Sequences

A sequence
AACATGGAGTGGACTGAGCAACAG
B sequence
GCTCTCTAAGTATCTCCTGTTGCT
AB sequence
AACATGGAGTGGACTGAGCAACAGGAGATA
Marker sequence
TAATGATGGTTGAGACTATAATAACTTCATCTGTTTCTAAGAAACTCTAC
TTTAATGCTGTGTTTTCATGGTATGTACACATTGCAGGTTAACATACCTG
CTGCTTATCTTAGTTCCAACATGGAGTGGACTGAGCAACAGGAGATACTT
AGAGAGCTCAATTCAGATGGTTGCAAATACAAATTTTTATATGTTACCCC
AGAGAAAGTTGCCAAGTGCGTACTCGTAATTTCATTTGGTAACATTTGAA
ACTTATGGTAACTTCTCTGAATGAAGTGTCTGATATTTAAGAGTAAAGAC
AAATCTTGAAGTTCCTTGTCACTTCCTTATTCCTTGGCTGATCTGTTATT
CTGGTGCAACTATGAAATAGTGAGATGCTAGCAGGAAAAATAAGTTCCTT
ACTGGAGGCATGAAAGCTTTCTGAAGGTGTGATGGATAAGCTCCTATTAA
TGAAC
Genomic location of TG245  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D135 marker 135
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)