SGN Marker T0055

SGN-M1352
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TOVBR32TH
Arabidopsis best BAC match: AC005824.2
Arabidopsis position: 2.1570000
Arabidopsis identities: 0.928
Best GenBank protein hit: AAC73045.1
Evalue: 2.5e-92
Identities: 0.899
Description: 60S ribosomal protein L10A [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39835)
Chromosome
10
Position
37.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0055 was used as an overgo probe on plate 6 [well F5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTATGCTTGGAGATGCTCAGCATG
B sequence
TTTTCTGCCTCTCCGACATGCTGA
AB sequence
GTATGCTTGGAGATGCTCAGCATGTCGGAG
Marker sequence
GCACGAGCCTAAATCGAGGGTTTTCTCTTACAGGTGAGTTTGAAGGAGGA
GAGATTTTTGAGCCATGAGTAAGCTTCAGAGTGAGGCCCTCAGAGAAGCC
ATCTCTGTGATTAAGAATGATTCAGCGGAGAAGAAAAGGAAGTTCAGCGA
GACCATTGAGCTCCAGATTGGATTGAAGAACTATGATCCCCAAAAGGACA
AGCGTTTCAGTGGATCTGTTAAGTTACCACACATTCCTCGCCCTAAGATG
AAGATCTGTATGCTTGGAGATGCTCAGCATGTCGGAGAGGCAGAAAAGAT
TGGTTTGGAGTACATGGATGTTGAAGGCTTGAAGAAGCTCAACAAGAACA
AGAAACTGGTCAAGAAACTTGCAAAGAAATACCATGCTTTCTTGGCTTCA
GAATCTGTCATCAAGCAGATTCCCCGTTTGTTGGGGCCTGGTCTGAACAA
GGCAGGTAAGTTTCCCACCCTTGTTTCCCACCAAGAGTCTCTTGAATCCA
AGGTTAATGAGACCAAGGCCACAATCAAGTTCCAATTGAAAAAGGTGCTC
TGCATGGGTGTTGCTGTTGGAAACATGGATATGGAGGAGAAGCAGATCTT
CCAGAATGTGCAAATGAGTGTCAACTTTCTTGTTTCATTGCTGAAGAAGA
ATTGGCAAAATGTTAAGTGCTTGTACTTGAAGAGCACCATGGG
Genomic location of T0055  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1352 marker 1352
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)