SGN Marker T0058

SGN-M1353
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVCA78TH
Arabidopsis best BAC match: AC003027.1
Arabidopsis position: 1.0070000
Arabidopsis identities: 0.826
Best GenBank protein hit: AAD10694.1
Evalue: 2.4e-63
Identities: 0.846
Description: unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39317)
Chromosome
9
Position
53.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0058 was used as an overgo probe on plate 1 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTGTGGTGAATGGCTACAATCCG
B sequence
CCCGTCCAGATCTTATCGGATTGT
AB sequence
AGTGTGGTGAATGGCTACAATCCGATAAGA
Marker sequence
GCACGAGGTTAGCGTAGCTTCAAAGACAATGTCGTTCGAGGAGGATGAAG
AATCGTTTGAGCACACGCTCCTTGTGGTGCGTGAGGTGTCTGTTTTCAAA
ATCCCGCCGCGTCCGACGAGCGGTGGTTACAAGTGTGGTGAATGGCTACA
ATCCGATAAGATCTGGACGGGTCGGCTCCGGGTTGTATCCTGTAAGGAAC
GTTGTGAGATCCGACTGGAGGATCCGAACTCAGCTGAGCTGTTCGCGGCG
TGTTTTGTGCCGCCGGGACAGAGAGAGAGCTCGGTGGAATCGGTGTTGGA
TTCGTCGAGGTACTTCGTGTTGAAGATCGAGGATGGGAGAGGGAAACATG
CGTTCATTGGACTAGGGTTTAACGAAAGGAATGAAGCATTTGATTTCAAT
GTGGCGTTATCTGATCATGAGAAGTATGTCAAGA
Genomic location of T0058  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1353 marker 1353
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)