SGN Marker T0086

SGN-M1355
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TOVDP80TH
Arabidopsis best BAC match: AF075598.1
Arabidopsis position: 4.0260000
Arabidopsis identities: 0.894
Best GenBank protein hit: AAA63452.1
Evalue: 2.7e-78
Identities: 0.987
Description: pyrophosphate-fructose 6-phosphate 1-phosphotransferase beta-subunit [Solanum tuberosum]
Comment: phosphofructokinase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49565)
Chromosome
2
Position
39.81 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47499)
Chromosome
2
Position
85.92 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39318)
Chromosome
2
Position
76.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0086 was used as an overgo probe on plate 1 [well H7]

Plausible BAC Matches:   P021C23,   P237I16,   P091C04,   P249C19,   P038L19,   P185O08,   P130A13,   P217C01,   P153L19,   P114O06,   P105H04

 Overgo Sequences

A sequence
GCACGAGATGATTTGCAGTGGTAG
B sequence
AGTCTCAATCTTGTCCCTACCACT
AB sequence
GCACGAGATGATTTGCAGTGGTAGGGACAA
Marker sequence
GCACGAGATGATTTGCAGTGGTAGGGACAAGATTGAGACTCCAGAGCAGT
TTAAGCAAGCTGAAGAGACAGCAAAGAAGCTCGATCTAGATGGTCTTGTC
GTAATTGGTGGAGATGACTCCAATACAAATGCTTGTCTTCTTGCTGAGAA
CTTCAGAAGTAAAAATTTGAAAACTCGGGTTATTGGATGCCCGAAAACCA
TAGATGGTGACTTAAAATCGAAAGAGGTTCCCACAAGTTTTGGCTTTGAT
ACGGCATGCAAGATATATGCAGAAATGATTGGGAATGTGATGGTAGATGC
TCGATCAACAGGAAAATACTATCATTTTGTGCGGCTCATGGGGCGTGCTG
CTTCACACATTACTCTAGAGTGTGCTCTGCAAACTCATCCAAACGTTACT
TTGATTGGAGAAGAGGTATTTGCAAAGAAACTGACTCTTAAGAATGTTAC
GGATTACATTGCTGATGTGGTCTGCAAGCGC
Genomic location of T0086  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1355 marker 1355
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)