Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0114

SGN-M1357
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPSAR65TH
Arabidopsis best BAC match: AB026648.1
Arabidopsis position: 3.0850000
Arabidopsis identities: 0.881
Best GenBank protein hit: AAA34075.1
Evalue: 3.2e-88
Identities: 0.957
Description: glyceraldehyde-3-phosphate dehydrogenase A-subunit precursor [Nicotiana tabacum]
Comment: plastidic
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39319)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0114 was used as an overgo probe on plate 1 [well A2]

Plausible BAC Matches:   P275M07,   P006P20,   P310G16,   P151F12,   P310D18,   P289K19

 Overgo Sequences

A sequence
GGAAGGATCTTGGTGTTGACTTGG
B sequence
CCGGTACCTTCAATGACCAAGTCA
AB sequence
GGAAGGATCTTGGTGTTGACTTGGTCATTG
Marker sequence
CTTGATGTCATTGCCATCAATGACTCTGGCGGTGTCAAGCAAGCCTCTCA
CCTCCTCAAGTATGACTCTACCCTCGGCATCTTCGATGCTGATGTTAAGC
CTGTTGGTACTGATGGCATCTCTGTTGATGGAAAGATCATCAAAGTCGTT
TCCGATCGTAACCCCATCAATCTCCCCTGGAAGGATCTTGGTGTTGACTT
GGTCATTGAAGGTACCGGAGTTTTTGTCGATCGAGAGGGTGCTGGCAAGC
ATATCCAAGCTGGAGCTAAGAAAGTCCTCATCACTGCCCCCGGAAAGGGT
GATATTCCTACCTATGTCGTTGGTGTCAATGCAGACCTTTACAGCCCTGA
TGAGTCCATTATCAGCAATGCTTCTTGCACCACAAACTGTCTTGCTCCTT
TTGTCAAAGTCCTTGACCAAAAATTCGGCATAATCAAAGGGACCATGACA
ACAACACACTCCTACACTGGTGACCAAAGGCTGCTTGATGCAAGCCACAG
GGACCTTAGACGTGCAAGAGCTGCAGCTCTCAACATTGTGCCAACTTCAA
CGGGTGCA
Genomic location of T0114  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1357 marker 1357
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)