SGN Marker T0123

SGN-M1361
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.10
Tomato EST read: TPRAA15TV
Arabidopsis best BAC match: U93215.2
Arabidopsis position: 2.1730000
Arabidopsis identities: 0.688
Best GenBank protein hit: AAC35857.1
Evalue: 6.2e-53
Identities: 0.955
Description: cinnamic acid 4-hydroxylase [Capsicum chinense]
Comment: phenylpropanoid metabolism: second step of Phe utilization
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39552)
Chromosome
2
Position
5.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0123 was used as an overgo probe on plate 11 [well F5]

Plausible BAC Matches:   P035A20,   P151D08,   P261A12,   P046G05,   P072G12,   P268B13,   P253F09,   P031A19,   P253F10,   P320G21,   P169E06,   P079K16,   P192F02

 Overgo Sequences

A sequence
GGAGGCAACATCTCAAAGTTCTGC
B sequence
CCATTGGACGTTTGGTGCAGAACT
AB sequence
GGAGGCAACATCTCAAAGTTCTGCACCAAA
Marker sequence
CGTCAAAATAATGCAATTGTCAGAAAGCCAAATTACCATTGTACATCATA
TAGGTAAAACTTATAATGAATCTAGTCTAATAAGACTTTTATGAAAAACA
TAAAAGAGAAGAAAATTTTCTGAACAAACAAACAACAGTCATAATTAACT
GATAGTATTACAAAGTTTAGAAAGATCTTGGTTTCATCACAATGGTGGAA
TGCTTCAAAATGTGGAGACTGAACTGTCCACCTTTCTCCGAGGTGTCGAG
CTTCGACTGCCCTGGAGGAGGCAACATCTCAAAGTTCTGCACCAAACGTC
CAATGGTGATGCCAAGAATTGGCAATGCAAGGATAATTCCGGGGCAACTC
CTGCTGCCAACACCGAAAGGAAGAAATCTGAAGTCGTTGCCATTGGCTTC
AACGTGTTTCTCCTCTTCCAAGAACCTCTCAGGTCTGAACTCTTCAGGTT
TCTTCCAGTGGGCGGGGTTGTTAGCTAGCCACCAAGCGTTAACTAAGATT
TTGCTCTCAGCTGGAATATCGTATGCAGCAAGCTTTGCATCATGAAGGTT
CATGTGTGGGACTAAAAGAGGAATT
Genomic location of T0123  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1361 marker 1361
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)