SGN Marker T0142

SGN-M1366
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.07
Tomato EST read: TSHAL21TH
Arabidopsis best BAC match: AB005246.1
Arabidopsis position: 5.2600000
Arabidopsis identities: 0.961
Best GenBank protein hit: BAB09833.1
Evalue: 6.0e-80
Identities: 0.940
Description: GcpE protein [Arabidopsis thaliana]
Comment: gcpE gene is essential for the MEP ( 2-C-methyl-D-erythritol 4-phosphate) pathway in Escherichia coli : procaryotic IPP biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39320)
Chromosome
11
Position
80.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0142 was used as an overgo probe on plate 10 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGGGAGTTACTGAAGCTGGTGAAG
B sequence
ATCCTTCCATCCTCACCTTCACCA
AB sequence
TGGGAGTTACTGAAGCTGGTGAAGGTGAGG
Marker sequence
GGCACGAGGACAAACCATGGGAGCCTTTCAGATCGCATTATGAGCTATTA
TGGGGACTCACCTAGGGGAATGGTAGAATCAGCATTTGAGTTTGCCAGAA
TTTGTAGAAAGTTGGACTTCCACAATTTTGTCTTCTCAATGAAAGCTAGC
AATCCAGTAGTTATGGTTCAGGCGTATCGCCTTCTTGTAGCTGAGATGTA
TGTTCAAGGATGGGATTATCCTTTACACTTGGGAGTTACTGAAGCTGGTG
AAGGTGAGGATGGAAGGATGAAGTCTGCAATCGGAATTGGCACACTTCTT
CAGGATGGTTTGGGTGATACGATACGGGTTTCCCTAACTGAAGCTCCAGA
AGAGGAGATAGATCCCTGTCGACGATTGGCAGACCTTGGTAAAAGAGCAG
CTGCGCTTCAGCAAGGAGTGGCCCCCTTTGAAGAAAAGCACAGACGTTAT
TTTGACTTTCAACGT
Genomic location of T0142  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1366 marker 1366
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)