SGN Marker T0147

SGN-M1367
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.01
Tomato EST read: TPSAP90TH
Arabidopsis best BAC match: AL392174.1
Arabidopsis position: 5.0149000
Arabidopsis identities: 1.000
Best GenBank protein hit: CAA58823.1
Evalue: 3.6e-22
Identities: 1.000
Description: NADH dehydrogenase [Solanum tuberosum]
Comment: Complex I subunit
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49441)
Chromosome
2
Position
44.27 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47375)
Chromosome
2
Position
103.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39321)
Chromosome
2
Position
96.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0147 was used as an overgo probe on plate 12 [well A3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACATGCTCCAAGAGGTGACAAAAC
B sequence
GTGTGCCCTTCAATCTGTTTTGTC
AB sequence
ACATGCTCCAAGAGGTGACAAAACAGATTG
Marker sequence
CAAAGTTGGAAGAGATTGACATGCTCCAAGAGGTGACAAAACAGATTGAA
GGGCACACTATTTGTGCCTTGGGTGACGCTGCTGCTTGGCCAGTACAGGG
TCTTATTAGGCACTTTAGACCAGAGCTAGAAAGGAGGATCAGGGAGCATG
CAGAGAGGGAGCTACAACAGGCAGCTGCTGCTTGATTCTTTTATGAGTTT
GCTGTTTGATACCATGGGAATAAATTTTGAGAAGTACCAGAAGTATGAAT
GTGGGAGGGGAAAGCAGGACGCAGAGCTTCCCTATATCCAGCCACTTTTT
ATTATCAAACTTGTGTAGAACTATTGTTACATTGTTGGCCCAATGGGTAA
TTTATGTTTCAGAGCTGGTACATCTAATGTCTTAATGTTTCCTTACATTA
TCATTGCCATGGTTTTGGTAGTTGAAAGATGCTTTAATATTTGTCATGTT
GCGTTAAATAAGATCTACACTTTGGC
Genomic location of T0147  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1367 marker 1367
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)