SGN Marker T0156

SGN-M1369
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.05
Tomato EST read: TOVAZ36TH
Arabidopsis best BAC match: AC002376.1
Arabidopsis position: 1.0100000
Arabidopsis identities: 0.804
Best GenBank protein hit: CAA53078.1
Evalue: 4.2e-97
Identities: 0.927
Description: acetyl-CoA C-acyltransferase [Mangifera indica]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41615)
Chromosome
3
Position
9.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43583
Forward primer (5'-3')
GCGGTTGATTCACATCGTAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CCTGTAGCACCCAAAGGATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39681)
Chromosome
9
Position
101.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13958
Forward primer (5'-3')
GCGGTTGATTCACATCGTAA
Digested band sizes (using MspI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 750
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCTGTAGCACCCAAAGGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13958
Forward primer (5'-3')
GCGGTTGATTCACATCGTAA
Digested band sizes (using MspI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 750
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCTGTAGCACCCAAAGGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 14140
Forward primer (5'-3')
GCGGTTGATTCACATCGTAA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 750
Solanum pimpinellifolium LA1589: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCTGTAGCACCCAAAGGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 120
Forward primer (5'-3')
Unknown
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 500
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0156 was used as an overgo probe on plate 15 [well A6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGACAAGGCAGGAACAAGATCAGG
B sequence
TGTGAATCAACCGCAGCCTGATCT
AB sequence
TGACAAGGCAGGAACAAGATCAGGCTGCGG
Marker sequence
GCACCAGGTGACAAGGCAGGAACAAGATCAGGCTGCGGTTGATTCACATC
GTAAGGCTGCTGCGGCCACTGCTTCTGGAAAATTCAAGGATGAAATAATT
CCTGTAGCCACGAAGATTGTTGACCCAAAAACGGGAGATGAGAAACCGGT
AACCATCTCTGTCGATGATGGAATACGACCAAATGCCAGTGTGTCAGACT
TGGCAAAATTGAAGCCAGTTTTCAAGAAGAGTGGAACTACTACTGCTGGG
AATTCCAGCCAAGTAACTGATGGTGCTGGAGCTGTACTGCTAATGAAAAG
AAGCATTGCAATGCAAAAGGGACTTCCTATCCTTGGTGTATTCAGAACCT
TTGCTGCGGTGGGTGTAGACCCTGCCATTATGGGAATTGGTCCAGCTGTT
GCAATTCCAGCTGCTGTCAAATCTGCAGGCCTTGAACTTGAAGATATTGA
TCTCTTTGAGATAAATGAGGCATTTGCATCACAATTTGTTTATTGCCGGA
AGAAGCTTGAACTTGACCCAGAAAAGATCAATGTCAATGGAGGTGCAATG
GCCATTGGTCATCCTTTGGGTGCTACAGGTGCAC
Genomic location of T0156  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1369 marker 1369
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)