SGN Marker TG247

SGN-M137

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2930
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG247 image not available
Forward sequence
CAGACAAGAAGAAAAAGAGGGTTAAGAAGTCGGTGGAAACCTACAAGATCTACATTTTCAAAGTGCTGAAACAGGTTCACCCTGACATTG
GTATATCTAGCAAGGCTATGGGTATTATGAACAGCTTTATCAATGACATTTTTGAGAAACTTGCTCAAGAGTCTTCTCGTCTTGCTCGCT
ATAACAAGAAGCCTACTATTACTTCTCGGGAGATCCAGACTGCTGTCAGATTGGTGCTCCCTGGTGAATTGGCTAAGCATGCTGTATCTG
AGGGTACAAAGGCTGTTACCAAATTTACCAGCTCTTAATCAGTCTTAGGGTTGTTTTATCAATTGTCTTGATTAGCGGTTGTGTTTTATC
TATTGTCTTGATTAGGGTTCATAGATGTATAAATTGTGCCATTAGCGCTCCTACTGAAAATTATGACAGCTATTTGTAGCTATTCAATCC
TTGAATGAAGAATTTCTAATTG
Reverse sequence
CCTCTTAACCTTTGCACTTTATTGACAGCCAATTTATTCCAATAGTAGAGAATCTGTCTTTTTAAGAGAAATTAGAACTTCTCTTACAGA
GTTTTGTCCAAATCTTAAACTTATTTCTAAGTCTACACAAACATATAAATCTCTCACTTCAATCCATTTAGTTCTTTTCCCACATCTCTA
GTGACCATTATCTTTATTTTCTACAAATATTTTTTTTTACAACAGAATTCTCAGGTCCTTGCTGAATGAAAAAACCACCCTTCAAACATG
TTATTTAGATCCCATTATGTAGTATATATAAGGCCACAAGGATTCCTACTAGAAAGATAGAAGGAAAACATGTGTAAGATAGATGCACTA
TATTATTTGTTACAACATAAATGAAGATAAACAGGATATAATTACACAAAAGTTCTCATTGTTATCGCAGATCTGGTACCATGGCGCTTT
CCCCCACAATGACATGGGACTTCCCATAATTCAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1446301.6e-19116 (24.6% of RFLP seq)+
SGN-U1614192.6e-21123 (26.1% of RFLP seq)+
SGN-U1446304.2e-23122 (25.8% of RFLP seq)+
SGN-U1548984.6e-32273 (57.8% of RFLP seq)+
SGN-U1446323e-33263 (55.7% of RFLP seq)+
SGN-U1446317.5e-34272 (57.6% of RFLP seq)+
SGN-U1465758.7e-46284 (60.2% of RFLP seq)+
SGN-U1452211.4e-47307 (65.0% of RFLP seq)+
SGN-U1619089.4e-52306 (64.8% of RFLP seq)+
SGN-U1465746e-53284 (60.2% of RFLP seq)+
SGN-U1465761.6e-56306 (64.8% of RFLP seq)+
SGN-U1446494.5e-66306 (64.8% of RFLP seq)+
SGN-U1473881.2e-69268 (56.8% of RFLP seq)+
SGN-U145016472 (100.0% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39960)
Chromosome
3
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8260)
Chromosome
3
Position
46.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8261)
Chromosome
3
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG247 was used as an overgo probe on plate 5 [well B2]

Plausible BAC Matches:   P031L20,   P028M14,   P080J09,   P099F05,   P106F12,   P118N04,   P116L19,   P214D17,   P279I06,   P048N18,   P007J09,   P260O15,   P244O24

 Overgo Sequences

A sequence
AGATCCAGACTGCTGTCAGATTGG
B sequence
AATTCACCAGGGAGCACCAATCTG
AB sequence
AGATCCAGACTGCTGTCAGATTGGTGCTCC
Marker sequence
CAGACAAGAAGAAAAAGAGGGTTAAGAAGTCGGTGGAAACCTACAAGATC
TACATTTTCAAAGTGCTGAAACAGGTTCACCCTGACATTGGTATATCTAG
CAAGGCTATGGGTATTATGAACAGCTTTATCAATGACATTTTTGAGAAAC
TTGCTCAAGAGTCTTCTCGTCTTGCTCGCTATAACAAGAAGCCTACTATT
ACTTCTCGGGAGATCCAGACTGCTGTCAGATTGGTGCTCCCTGGTGAATT
GGCTAAGCATGCTGTATCTGAGGGTACAAAGGCTGTTACCAAATTTACCA
GCTCTTAATCAGTCTTAGGGTTGTTTTATCAATTGTCTTGATTAGCGGTT
GTGTTTTATCTATTGTCTTGATTAGGGTTCATAGATGTATAAATTGTGCC
ATTAGCGCTCCTACTGAAAATTATGACAGCTATTTGTAGCTATTCAATCC
TTGAATGAAGAATTTCTAATTG
Genomic location of TG247  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D137 marker 137
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)