SGN Marker T0161

SGN-M1370
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.25
Tomato EST read: TOVCI86TH
Arabidopsis best BAC match: AC002411.1
Arabidopsis position: 1.0080000
Arabidopsis identities: 0.937
Best GenBank protein hit: AAC16754.1
Evalue: 1.4e-68
Identities: 0.871
Description: Strong similarity to MRP-like ABC transporter gb|U92650 from A. thaliana [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39704)
Chromosome
9
Position
50.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0161 was used as an overgo probe on plate 6 [well H8]

Plausible BAC Matches:   P024L03,   P221N06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTTCAACCGTTGGCCTTCATGACC
B sequence
CTCAGACGACTACGAAGGTCATGA
AB sequence
TTTCAACCGTTGGCCTTCATGACCTTCGTA
Marker sequence
GCACCTGATGGAGAGAATTGGAGTGTGGGCCAGCGACAGCTTGTATCTCT
TGGGCGGGCTTTACTTAGACAACATTGATATTTCAACCGTTGGCCTTCAT
GACCTTCGTAGTCGTCTGAGTATAATTCCCCAAGATCCAACATTATTTGA
AGGGACAATTCGTGACAACCTTGACCCACTTGACGAACATTCAGATCTAG
ACGTATGGCAGGCACTTGAAAAGTCCCAGCTTGGAGAGGTTGTCAGGAAT
AAAGATCAAAAGCTTGATACACCAGTCCTGGAGAATGGAGAGAATTGGAG
TGTGGGCCAGCGACAGCTTGTATCTCTTGGGCGGGCTTTACTTAAACAAG
CCAAAATTTTGGTGCTTGATGAAGCGACGGCCTCGGTTGACTCAGCAACA
GATAACCTCATCCAGAAGATTATTAGGACAGAGTTTAAGGACTGCACTGG
TTGCACCATTGCACATCGTATCCCTACAGTTATTGACAGTGATCTTTGCC
TGGTCCTCAGTGATGG
Genomic location of T0161  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1370 marker 1370
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)