SGN Marker T0173

SGN-M1372
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TPSAJ05THB
Arabidopsis best BAC match: AC002510.2
Arabidopsis position: 2.2260000
Arabidopsis identities: 0.939
Best GenBank protein hit: AAB84351.1
Evalue: 1.3e-10
Identities: 0.939
Description: putative thioredoxin reductase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39322)
Chromosome
10
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0173 was used as an overgo probe on plate 16 [well D8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P290P12,   P289C16,   P028D05,   P108F02,   P244N07,   P044H11,   P026G09

 Overgo Sequences

A sequence
GATCCAGAGATTGCTGAGGCAGCT
B sequence
GAGTACCCATAATCCCAGCTGCCT
AB sequence
GATCCAGAGATTGCTGAGGCAGCTGGGATT
Marker sequence
GTTGAAATTGATATTACTGAAGATCCAGAGATTGCTGAGGCAGCTGGGAT
TATGGGTACTCCATGTGTACAGTTTTTCAAGAACAAGGAGATGCTCAGGA
CGGTATCAGGTGTTAAAATGAAGAGAGAGTATAGAGAGTTTATTGAAGCA
AATAAGTGAAGGCTTGCTTCTTTGTTAATTATTTGTACAACTTCCTTTTT
TTTTTACCCTTCACGAAGTTTTACTTATTTTTTTTAATGCATGGTACCCA
AATCAATTTTGTTCAGAATGGTTGATTGAGTAACAGCCCAATACCTTGTA
TTAGCTTTATTN
Genomic location of T0173  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1372 marker 1372
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)