SGN Marker T0182

SGN-M1375
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.04
Tomato EST read: TOVDS41TH
Arabidopsis best BAC match: AF069442.1
Arabidopsis position: 4.0180000
Arabidopsis identities: 0.926
Best GenBank protein hit: AAD15337.1
Evalue: 7.0e-72
Identities: 0.944
Description: mitochondrial elongation factor Tu [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49497)
Chromosome
9
Position
61.16 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47431)
Chromosome
9
Position
55.52 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39323)
Chromosome
9
Position
54.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0182 was used as an overgo probe on plate 15 [well B11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGGTGATAATGTCGGGCTTCTTC
B sequence
CGTTTCAAGCCACGTAGAAGAAGC
AB sequence
CTGGTGATAATGTCGGGCTTCTTCTACGTG
Marker sequence
GGGAACCTTAAAATCTACAGTGACTGGTGTCGAAATGTTCAAGAAGATCT
TGGATAATGGTCAAGCTGGTGATAATGTCGGGCTTCTTCTACGTGGCTTG
AAACGAGAAGATATTACACGAGGAATGGTAATTGCAAAGCCTGGTAGTGT
GAAAACGTCCAAGAAATTTGAGGCAGAAATATACGTACTAACTAAGGATG
AAGGTGGTCGGCACACTGCTTTTTTCTCAAACTATAGGCCTCAGTTCTAC
ATGAGAACTGCTGACATTACCGGTAAAGTGGAGTTGCCTGAAAATGTCAA
GATGGTTATGCCCGGTGATAATGTTACAGCTACCTTTGAGCTGATATCTC
CAGTTCCTCTTGAAACAGGACAAAGATTTGCCCTGAGAGAGGGTGGCAGA
ACGGTTGGTGCTGGGGTTGTTTCTAAAGTACTGAGCTGAGGGTTCTGAAA
ATGCAAGCTTCAGTTTCAGTCTGGTTTGTCTCAAGAGGAGCTGA
Genomic location of T0182  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1375 marker 1375
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)