SGN Marker T0200

SGN-M1379
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TPSAP79TH
Arabidopsis best BAC match: AL035522.1
Arabidopsis position: 4.1790000
Arabidopsis identities: 0.957
Best GenBank protein hit: AAD41256.1
Evalue: 8.4e-91
Identities: 1.000
Description: catalase 2 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39817)
Chromosome
2
Position
81.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0200 was used as an overgo probe on plate 13 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCTCTTACGGTTGGTGCAAGAG
B sequence
TCAAGCAACACAGGACCTCTTGCA
AB sequence
CATCTCTTACGGTTGGTGCAAGAGGTCCTG
Marker sequence
CTTACAAGTACCGTCCGTCAAGTGCTTTCAATTCACCTTTCTGTACCACT
AATTCTGGTGCTCCTGTTTTTAATAACAATTCATCTCTTACGGTTGGTGC
AAGAGGTCCTGTGTTGCTTGAGGATTACCATTTGGTGGAGAAACTTGCCA
ACTTTGACAGGGAACGTATTGCAGAACGTGTTGTTCATGCCCGAGGTGCT
AGTGCCAAAGGGTTTTTTGAAGTTACTCATGACATTGCTCACCTTACCTG
TGCTGATTTCCTTCGAGCTCCTGGTGTACAGACTCCAGTCATTGTGAGAT
TCTCTACTGTTATTCATGAAAGGGGTAGTCCTGAAACTCTGAGGGATCCT
CGTGGTTTTGCTGTCAAGTTTTACACCAGAGAGGGAAACTTTGATCTGGT
AGGGAACAACTTCCCCGTCTTCTTCATCCGTGATGGAATGAAGTTCCCTG
ACATGGTCCATGCTCTGAAGCCAAATCCTAAGT
Genomic location of T0200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1379 marker 1379
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)