SGN Marker T0246

SGN-M1388
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TOVAM10TH
Arabidopsis best BAC match: AC002388.2
Arabidopsis position: 2.2410000
Arabidopsis identities: 0.888
Best GenBank protein hit: AAC31838.1
Evalue: 1.4e-44
Identities: 0.659
Description: 60S ribosomal protein L30 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49502)
Chromosome
10
Position
59.72 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47436)
Chromosome
10
Position
44.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39327)
Chromosome
10
Position
50.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0246 was used as an overgo probe on plate 6 [well B4]

Plausible BAC Matches:   P138P08,   P131K01,   P151G22,   P302A22

 Non-Plausible BAC matches

P281H24,   P205G15,   P149M04,   P020A12

 Overgo Sequences

A sequence
CATATAGACGGCTGCATGGAAAGG
B sequence
GAGTCCTGAGTCATGTCCTTTCCA
AB sequence
CATATAGACGGCTGCATGGAAAGGACATGA
Marker sequence
GCACGAGGTTCTGTAGGTCTAAGTGCCACAAGAACTTTAAGATGAAGAGG
AATCCTCGTAAAGTTAAATGGACTAAAGCATATAGACGGCTGCATGGAAA
GGACATGACTCAGGACTCAACATTTGAATTCGAGAGGAAGCGTAATAGGC
CAGAGAGATATGACAGGAATGTAACTGAGAACACTTTGAAGGCCATCAAG
AAAATTGATAAAATCAGAGTTGACAGGGAGGAGAGACATATTGCAAAGAG
GATGAAAGGAAATAAAGCCAAGGAGCAGAGAGAAGCAACAAAGGAGCTCG
AGCAGAGCATTCACATGGTCAAAGCTCCTTCTGTGCTCTTCAAAGAGCCA
TCACTTACACTACCTACCAAGGTCAAGGTTTTGCAAAAGCAGTCAGAGGA
AAATCGCATGGAGGAATGAACATTTCGCTTCCCATATTCTATTTTTTCAA
ACTAAAAAAACACTAAATCGGTCCATACTTATTTTTGCAGTATGTATAAC
ATTTTGATGACATTGACATGCTAAGCTNTCCCTTACCTTCAGAATAGTAA
TGGTTTTTCGACTTAGTCTTTGGCGTAGAA
Genomic location of T0246  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1388 marker 1388
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)