SGN Marker T0270

SGN-M1392
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TOVBP41TH
Arabidopsis best BAC match: AL096860.1
Arabidopsis position: 3.1100000
Arabidopsis identities: 0.915
Best GenBank protein hit: AAD05035.1
Evalue: 8e-106
Identities: 0.947
Description: asparagine synthetase [Triphysaria versicolor]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49503)
Chromosome
6
Position
1.24 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47437)
Chromosome
6
Position
1.62 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39820)
Chromosome
6
Position
3.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0270 was used as an overgo probe on plate 3 [well B3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAGTGAAGATGGTCATATCAGGAG
B sequence
ATTTCGTCAGCGCCTTCTCCTGAT
AB sequence
GAGTGAAGATGGTCATATCAGGAGAAGGCG
Marker sequence
GCACGAGAAGATGTTATATATCATATCGAAACGTATGATGTAACAACAAT
AAGAGCAAGCACTCCTATGTTCCTTATGTCGCGTAAGATCAAATCACTAG
GAGTGAAGATGGTCATATCAGGAGAAGGCGCTGACGAAATTTTTGGTGGC
TACTTATACTTCCACAAGGCTCCCAACAAGGAGGAGTTCCACAGGGAAAC
ATGTCGCAAGATAAAAGCTCTTCACCAGTATGACTGTTTAAGAGCAAACA
AGGCAACGTCTGCGT
Genomic location of T0270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1392 marker 1392
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)