SGN Marker T0275

SGN-M1393
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TOVBZ60TH
Arabidopsis best BAC match: AC009243.3
Arabidopsis position: 1.1490000
Arabidopsis identities: 0.873
Best GenBank protein hit: AAF76898.1
Evalue: 5.4e-46
Identities: 0.852
Description: "apetala2 domain-containing protein [Atriplex hortensis]/ e-43, AP2 domain containing protein RAP2.4 [Arabidopsis thaliana]"
Comment: ap2:transcription factor?
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53144)
Chromosome
4
Position
47.74 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39328)
Chromosome
4
Position
79.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0275 was used as an overgo probe on plate 1 [well H9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACCAAAACCCACGAAGCTCTACAG
B sequence
GCGTTGTCTAACACCTCTGTAGAG
AB sequence
ACCAAAACCCACGAAGCTCTACAGAGGTGT
Marker sequence
TTCCACCATGAATTTCTTGGCTCCAAAGCCGGTTCCAATGAAGCAATCTG
GGTCGCCACCAAAACCCACGAAGCTCTACAGAGGTGTTAGACAACGCCAC
TGGGGTAAGTGGGTCGCTGAGATCCGTTTGCCTAAGAACCGAACCCGCCT
TTGGCTTGGTACATTTGACACCGCTGAAGAAGCTGCTCTGGCTTACGACA
AGGCGGCGTATATGCTTCGTGGCGACTTTGCTCGACTGAACTTCCCTCAA
CTCCGCCACAACGGCAACCTAATCGGCGGCGACTTTGGTGAATACAATCC
ATTGCATTCCTCAGTTGATGCTAAGCTAAAGGACATATGCCAAAGCTTGG
CACAGGGGAAGAGCATTGACTCTAAGAAGAAGAAAACCAAAGGGTTGTCG
GCGGAGAAAGCGGCGGTGGTGAAGATGGAGGAAGAGGAGAGCAAAACAGC
AGAAGTTGGATCCGAAAGTGACGGGTCCCATTCCGGTTCCGGTGGATCAT
CGCCGGTGACCGAACTGATATTCCCGGAGTTCACTGAGGAAGAGCCAACT
TGGGACATGTCAGAAAA
Genomic location of T0275  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1393 marker 1393
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)