SGN Marker T0283

SGN-M1395
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TOVCN46TH
Arabidopsis best BAC match: AC002329.2
Arabidopsis position: 2.1010000
Arabidopsis identities: 0.853
Best GenBank protein hit: AAC49405.1
Evalue: 5.7e-95
Identities: 0.916
Description: calcium dependent protein kinase [Vigna radiata]
Comment: CDPK
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39329)
Chromosome
1
Position
165.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39330)
Chromosome
10
Position
36.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14083
Forward primer (5'-3')
GGAGACGAACAATGCGAAAT
Digested band sizes (using BglII)
Solanum pimpinellifolium LA1589: 200+420+1100+1400+1500
Solanum lycopersicum LA925: 100+420+1100+1500
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCTCACAACAAATCGTGGAA
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0283 was used as an overgo probe on plate 3 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGATACGGGAACTTATGGATGC
B sequence
ATTGTCCACATCAGCCGCATCCAT
AB sequence
GGAGATACGGGAACTTATGGATGCGGCTGA
Marker sequence
GTACTTTCTCGCCTAAAACAGTTCTCTGCTATGAACAAGTTAAAAAAGAT
GGCTTTGCGGGTGATTGCTGAAAGCTTGTCTGAAGAAGAGATTGCTGGTC
TGAGAGAGATGTTTAAGGCCATGGATACTGACAATAGTGGTGCAATTACA
TTTGATGAACTAAAAGCAGGGTTGAGAAAATATGGCTCTACCTTAAAGGA
TACGGAGATACGGGAACTTATGGATGCGGCTGATGTGGACAATAGTGGAA
CTATTGACTATGGAGAATTCATTGCGGCAACTGTTCATCTTAATAAATTG
GAGCGCGAGGAACATCTCATGGCAGCATTTCAATATTTTGACAAGGATGG
AAGTGGTTACATAACAGTTGATGAGGTCCAGCAAGCTTGTATAGAGCATA
ACATGACAGATGTTTACTTTGAGGATATTATAAGAGAAGTCGATCAGGAT
AATGATGGACGAATTGATTATGGAGAATTTGTTGCTATGATGCAAAAAGG
AAATCCGTGTATAGGGAGACGAACAATGCGAAATAGTCTGAATTTGAGCA
TGAGAGATGCATCAGGAGCTCAGTAGTAGCTTCTCAGACAGACATCTCTA
CTAGGTTGTACAGAAAAGAGGCCAGGGCAATAGACTTTCATCCAGTAACA
TCCAGTACCTTCGAGTTTGCTAGAAGAGGATGAGTGAAAGACCCTATCGG
ACAGCTCT
Genomic location of T0283  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1395 marker 1395
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)