Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0292

SGN-M1397
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVCW86TH
Arabidopsis best BAC match: AL078637.1
Arabidopsis position: 4.1240000
Arabidopsis identities: 0.837
Best GenBank protein hit: CAB79348.1
Evalue: 3.9e-46
Identities: 0.763
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39331)
Chromosome
4
Position
85.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0292 was used as an overgo probe on plate 8 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGAAGTGTAGGTGATTCGAAAAC
B sequence
GGGTTTCCTCTGATGAGTTTTCGA
AB sequence
GGGAAGTGTAGGTGATTCGAAAACTCATCA
Marker sequence
TATTGCTACCATGGGAAGTGTAGGTGATTCGAAAACTCATCAGAGGAAAC
CCAGATTTTTGTGCCTTCATGGATTTCGAACAAGTGGGAAAATTTTGAAG
AAGCAAATATTTGATAAATGGCCAACTGAAGTTGTGGATAAATTAGATCT
AGTTTTTGTTGATGCGCCTTTTCCATCTCAAGGAAAATCTGAAGTTGAAG
GCATCTTTGACCCTCCCTATTACGAGTGGTTTCAATTCAATAAGGAATTT
ACAGAGTATGAGAATTTTGATAAATGTCTTGAATACATAGAAGAATGTAT
GATCAAACATGGACCTTTCGATGGTCTTCTTGGTTTCTCTCAGGGGGCAA
TTCTTTCTCGAGCATTGTCGGGGTTGCAGGCTAAGGAAGTGGGACTTACA
AAGGCATCAAAAATTAAATATCTGATCATAATTGGAGGTGCTAAATTTTC
G
Genomic location of T0292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1397 marker 1397
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)