SGN Marker T0308

SGN-M1402
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.1
Tomato EST read: TPRAB01TH
Arabidopsis best BAC match: AL031135.1
Arabidopsis position: 4.1820000
Arabidopsis identities: 0.888
Best GenBank protein hit: CAA74776.1
Evalue: 9.4e-98
Identities: 0.965
Description: NAD-dependent isocitrate dehydrogenase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39823)
Chromosome
10
Position
36.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0308 was used as an overgo probe on plate 6 [well E6]

Plausible BAC Matches:   P211P08,   P246M13,   P046K11,   P286I11,   P157G16,   P140P20,   P178A23

 Overgo Sequences

A sequence
ATTCCGGATTGGAGCATGAGGTTG
B sequence
TCTACAACACCGGGAACAACCTCA
AB sequence
ATTCCGGATTGGAGCATGAGGTTGTTCCCG
Marker sequence
AGGCCTTCCTACGCGTCATGAGAATGTTGATATTGTTGTTATTAGGGAGA
ATACTGAGGGCGAATATTCCGGATTGGAGCATGAGGTTGTTCCCGGTGTT
GTAGAGAGTCTCAAGGTGATGACAAAGTTTTGCTCAGAAAGAATTGCTAA
ATATGCCTTTGAATATGCATACCTCAACAATCGGAAGGTAGTGACTGCTG
TGCACAAGGCAAACATTATGAAACTTGCTGATGGTTTATTTTTGGAGTCT
TGTCGAGAGATCGCAAGCAAATACCCTGGGATCAAGTACAATGAGATAAT
TGTGGACAACTGTTGCATGCAACTTGTATCAAAGCCTGAGCAATTTGATG
TTATGGTCACCCCTAATCTCTACGGAAATCTGGTAGCAAATACAGCAGCT
GGTATTGCTGGAGGCACAGGTGTTATGCCAGGAGGCAATGTGGGGGCTGA
CCATGCCGTGTTTGAGCAAGGTGCTTCAGCAGGAAATGTAGGAAATGAAA
AGATACTAGAGCAAAAGAAGGCAAACCCAATTGCCTTGTTTCTTTCATCA
GCCATGATGTTGAGACATCTGCAGTTCCCTTCATTTGCAGATAGACTAGA
GACTTCAGTGAAGCGT
Genomic location of T0308  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1402 marker 1402
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)