SGN Marker TG13

SGN-M141

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
AATCCATGGAAGAGTGAACTTCATCTGAAAGAGGCTGTGATGATTATTGTTTATCGGCATTTACAAAAATGGTCTTTTTTTGAGGCCACT
TTAAATTCCGTGCTCATTTCCTTTTGGGCATAGAGACATCCTGACCTGTATCTTGGCTTGGCAAACACCAACAAGGGCTGTGATTTTAGG
CTTCTCTTTCACAATCCAATTGGTTATTTTGCATCCATGGCATGGTTGCCTTATCTTTACCCCAATAGAAAATTGAGACTGAGCCTCATT
TTCCAAATTTCCTTCCTTACAACCTGGGAATAGAACACGAGACCTTCTTTGACGGAGAGAGATCAATAACACCCTCTTTATGCGACCGTT
GATAGTTTTCAATGGTAATTTACTCTGGAATTGGTATTCTTTAGTTTTATGTGTTAAGAATGACGTGATAACCAACTACACCACCACAAA
GGATTCTCGATGTGGATGACCATCTTTAACATGCCAATGATTTTTT
Reverse sequence
AGAGCCGAAATTTCAACACACGCAATAGGTTTTCCAACCAGGGAATAGACTCACCATGGAAGATCATGAAATGGGTTATTCAGGGCTCAG
ATTTGTTGTATTTCTTAACAAAGAAAAGAGAAGAACGCCACAGCCATGGATGCAGACACCAGTTTGCTATTCAAAGCCATAACCGGGTCG
CCCAGCTAAGATGCAGGTTTTTCTCAATGCTATATTGAACACAGCTTCATAGCCCAAAAAGGAAAGTAAGCAATCATCATAGCCCCCTTT
ACAACACCAGCAGCAGCAACAGCATCACAAGAAGACGAGAGGAAGAACAACAAGAGTACAGAGGTGTGTTTGGATGACATTTTTTTCCCT
TTTGTTTATTTAAAAGGGCTGTTATTTTTTGGTTATCAATGGAAAAATCACTGGCAAAGCAGAGACGGGCAACCACCCTTTTACAGAAAA
TCCCAATTTCTCTGATGCTTCATTCTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1559412.4e-1581 (17.0% of RFLP seq)-
SGN-U1699266.1e-16125 (26.2% of RFLP seq)-
SGN-U1559414e-2073 (15.3% of RFLP seq)-
SGN-U1559417.1e-28118 (24.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53177)
Chromosome
7
Position
37.82 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53178)
Chromosome
3
Position
42.44 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43832)
Chromosome
3
Position
14.40 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43292)
Chromosome
3
Position
14.70 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8284)
Chromosome
7
Position
0.50 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8283)
Chromosome
3
Position
35.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8286)
Chromosome
7
Position
59.20 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8285)
Chromosome
3
Position
10.40 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG13 was used as an overgo probe on plate 3 [well B12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P271K20,   P121B23,   P016E01,   P260B24,   P055O01,   P104K22,   P208M07,   P089G23,   P289I19,   P009B16,   P002D20,   P104H01,   P113C22,   P140A16,   P186B07,   P251C19,   P176A05,   P110B12

 Overgo Sequences

A sequence
CATCCTGACCTGTATCTTGGCTTG
B sequence
CCTTGTTGGTGTTTGCCAAGCCAA
AB sequence
CATCCTGACCTGTATCTTGGCTTGGCAAAC
Marker sequence
AATCCATGGAAGAGTGAACTTCATCTGAAAGAGGCTGTGATGATTATTGT
TTATCGGCATTTACAAAAATGGTCTTTTTTTGAGGCCACTTTAAATTCCG
TGCTCATTTCCTTTTGGGCATAGAGACATCCTGACCTGTATCTTGGCTTG
GCAAACACCAACAAGGGCTGTGATTTTAGGCTTCTCTTTCACAATCCAAT
TGGTTATTTTGCATCCATGGCATGGTTGCCTTATCTTTACCCCAATAGAA
AATTGAGACTGAGCCTCATTTTCCAAATTTCCTTCCTTACAACCTGGGAA
TAGAACACGAGACCTTCTTTGACGGAGAGAGATCAATAACACCCTCTTTA
TGCGACCGTTGATAGTTTTCAATGGTAATTTACTCTGGAATTGGTATTCT
TTAGTTTTATGTGTTAAGAATGACGTGATAACCAACTACACCACCACAAA
GGATTCTCGATGTGGATGACCATCTTTAACATGCCAATGATTTTTT
Genomic location of TG13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D141 marker 141
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)