SGN Marker T0328

SGN-M1410
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPSAF86TH
Arabidopsis best BAC match: AC005168.2
Arabidopsis position: 2.1510000
Arabidopsis identities: 0.819
Best GenBank protein hit: AAC32250.1
Evalue: 2.4e-31
Identities: 0.922
Description: putative Na+ dependent ileal bile acid transporter [Arabidopsis thaliana]/ no other significant hits
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49505)
Chromosome
5
Position
19.28 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47439)
Chromosome
5
Position
80.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39333)
Chromosome
5
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0328 was used as an overgo probe on plate 11 [well D12]

Plausible BAC Matches:   P021G07,   P303C11,   P296M02,   P270L06,   P300I08,   P035E17,   P030N19,   P188G07,   P161A20,   P147M04,   P124A03,   P270B01,   P203K19

 Overgo Sequences

A sequence
ATTGGTCAAGTCGCAGATGTGCTG
B sequence
GTGCTCCCTGAGTTTTCAGCACAT
AB sequence
ATTGGTCAAGTCGCAGATGTGCTGAAAACT
Marker sequence
TCGTCACCATCACACCTTTAATTGGAGTTATTCTGACTACTCTTCTTTGT
GCTAGTCCGATTGGTCAAGTCGCAGATGTGCTGAAAACTCAGGGAGCACA
GTTACTTCTCCCTGTGGCGGCCTTGCATGCTGCAGCATTTTTTCTGGGTT
ACCAGATTTCAAAATTTTCATTTGGTGAATCAACATCCAGAACTATTTCG
ATAGAATGTGGAATGCAGAGTTCGGCACTCGGATTTCTACTTGCACAAAA
GCATTTCACAAACCCTCTTGTTGCTGTACCTTCTGCTGTTAGTGTTGTCT
GCATGGCACTTGGTGGAAGTGCTCTAGCTGTGTACTGGAGGAATCAACCA
ATTCCTGTTGATGACAAGGATGATTTTAAGGAGTAACCTCTGCTGCTGCT
TCTTTACATGTCGTTAGTTTGTGAGATGAAGTTGAAAGATCCACAGTCAT
GCAAATGCATGGTTTGGTAG
Genomic location of T0328  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1410 marker 1410
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)