SGN Marker T0337

SGN-M1414
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TPSAL05TH
Arabidopsis best BAC match: AL031018.1
Arabidopsis position: 4.1180000
Arabidopsis identities: 0.921
Best GenBank protein hit: AAB71230.1
Evalue: 1.3e-77
Identities: 0.985
Description: gamma-glutamylcysteine synthetase [Lycopersicon esculentum]
Comment: involved in glutathione biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49506)
Chromosome
8
Position
61.31 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47440)
Chromosome
8
Position
90.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39334)
Chromosome
8
Position
71.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0337 was used as an overgo probe on plate 12 [well F8]

Plausible BAC Matches:   P312I09,   P024A19,   P072G08,   P041I09,   P248B22,   P335I22,   P194B16,   P089A23,   P257J22,   P089C22,   P296A01,   P009B23,   P089B22,   P081D03,   P090A22,   P225C16,   P082G11,   P218D16,   P093F09,   P167D14,   P147D05,   P184K06,   P317B20,   P315A05,   P238O12,   P251H04,   P234H01,   P191C11,   P316E01,   P123M01,   P106G10,   P089A22

 Overgo Sequences

A sequence
TAGAACCTGGTGGTCAGTTTGAGC
B sequence
AGTGGTGCACCACTAAGCTCAAAC
AB sequence
TAGAACCTGGTGGTCAGTTTGAGCTTAGTG
Marker sequence
AACTTGATGAGCAGGATAGGCACTGAACATGAAAAGTTTGGTTTCGAGTT
TGGAACCCTGCGACCCATGAAGTATGATCAAATAGCTGACTTGCTAAATG
GTATTGCTGAGCGGTTTGATTGGGAAAAAGTAATGGAGGGTGACAAGATT
ATTGGCCTGAAACAGGGAAAGCAAAGCATATCATTAGAACCTGGTGGTCA
GTTTGAGCTTAGTGGTGCACCACTTGAAACACTGCATCAAACTTGTGCAG
AGGTTAATTCACATCTTTACCAGGTTAAAGCTGTTGCAGAAGAGATGGGA
ATTGGATTCTTAGGAACTGGATTCCAGCCAAAGTGGGGGCTGAAAGATAT
ACCAATAATGCCGAAGGGGAGATATGAGATTATGAGAAATTACATGCCTA
AAGTTGGCTTACTTGGGCTGGATATGATGTTT
Genomic location of T0337  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1414 marker 1414
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)