SGN Marker T0343

SGN-M1415
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05
Tomato EST read: TPSAK42TH
Arabidopsis best BAC match: AB015478.1
Arabidopsis position: 5.2020000
Arabidopsis identities: 0.880
Best GenBank protein hit: BAA94084.1
Evalue: 8.5e-78
Identities: 0.830
Description: NAD-dependent sorbitol dehydrogenase [Prunus persica]
Comment: conversion of sorbitol to fructose
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42388)
Chromosome
1
Position
18.70 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39335)
Chromosome
1
Position
18.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10505)
Chromosome
1
Position
20.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0343 was used as an overgo probe on plate 3 [well G10]

Plausible BAC Matches:   P267L02

 Overgo Sequences

A sequence
CCAGGTGGCAAAGTTTGCTTGGTT
B sequence
CATGATGTCCCATTCCAACCAAGC
AB sequence
CCAGGTGGCAAAGTTTGCTTGGTTGGAATG
Marker sequence
TGGGCTTGTCACGCTGCTTGCTGCTCGTGCTTTTGGTGCCCCAAGAATTG
TTATTGTGGATGTAGATGACTATCGTCTTTCTGTTGCAAAGAAGTTAGGA
GCAGATGACATCGTCAAGGTTTCAATCAATATTCAGGATGTAGCTACAGA
TATAGAAAACATTCAGAAAGCAATGGGAGGTGGAATCGACGTGAGTTTTG
ACTGTGCTGGCTTTAACAAAACTATGTCGACCGCTCTTGGTGCAACTCGT
CCAGGTGGCAAAGTTTGCTTGGTTGGAATGGGACATCATGAGATGACCGT
TCCTCTCACTCCAGCTGCTGCAAGGGAGGTCGACGTCATCGGCATATTTC
GCTACAAGAATACATGGCCATTGTGTCTTGAGTTCTTAAGAAGTGGTAAG
ATTGATGTGAAACCTTTGATCACACACAGGTTTGGATTCTCTCAAGAAGA
AGTTGAAGAAGCTTTTGAAACAAGTGCTCGTGGTGGTGATGCTATTAAAG
TCATGTTTAATTTGTAAAAAAAAAAATACTTTTTAAATTTTGAGAAAATA
AG
Genomic location of T0343  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1415 marker 1415
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)