SGN Marker T0347

SGN-M1416
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPSAL73TH
Arabidopsis best BAC match: AC009755.5
Arabidopsis position: 3.0040000
Arabidopsis identities: 0.793
Best GenBank protein hit: AAF02126.1
Evalue: 8.3e-46
Identities: 0.789
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49507)
Chromosome
2
Position
45.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47441)
Chromosome
2
Position
123.13 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39336)
Chromosome
2
Position
111.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0347 was used as an overgo probe on plate 10 [well H10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCATCCAATGCTTCAGTGGTTGAG
B sequence
TTCTTGAGGCGACATCCTCAACCA
AB sequence
CCATCCAATGCTTCAGTGGTTGAGGATGTC
Marker sequence
CAGGCAACTCGTTGCATGTGGTCATTCACACACACTTACTTCTGCTAAAG
ACGGACGAATACATGGATGGGGTTATAACTGCTATGGTCAAGCGGCTAAT
GAGAAGTCTACATATGCCTGGTGTCCATCACCAGTTGATTGGTGTGTTGG
GGCAGTCCGAAAATTGGCTGCTGGCGGTGGACATTCAGCAGTGCTGACTG
ATGCATGCTCTCTAAAAGAGCTGTGTGAATTTAGGCTTGCAGAAACAGTG
AATCCATCCAATGCTTCAGTGGTTGAGGATGTCGCCTCAAGAACAGGAGC
TGATGCTTTAGCACGACTTTGTGAAAGATTGACGGAGCATTACTACAATG
ATGATGAGTTTGGTCTGTGAAATCATTGATGGGCGTTAAATATGTAACAT
ACCAATAATTCAGCCATTAGATCTGATTCTTCAATCCATCT
Genomic location of T0347  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1416 marker 1416
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)