SGN Marker CT11

SGN-M142

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pCR1000
Cutting Site
HindIII/EcoR1
Drug Resistance
KN
Image
CT11 image not available
Forward sequence
not available
Reverse sequence
CCAAGATTGCTTGTTTGGTGGTTTTATGCATGTTGATTACAAATGCACCCCATGCAAAGGCAGTGACTTGTGGCCAAATTCAGGTTGGGG
TAGTGAATTGCCTTCCTTATTTGCAGAACCGTGGGCCAATAGGAGGCTGTTGTGGTGTCATTAAAGATTTGCTTAAGCTTTGTAAGACAC
CACATGAACGTAGAAAATCATGTAAGTGTGTCAAAAAAGCTGCTAATACTATTAAAGGCATTGATTTTGGTAAAGCTGCTGGTCTTTCTG
GAGTTTGTGGTGTCAAGATTCCTTTTGAGATCAGCCCCTCTGTTGACTGCTCCAAGTATGTTTTCAGTTATCGGTTGACCTAATTTAATC
TTAAAAGCTGAATATTTAATGTGTCTTTGGTAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1542161.8e-0686 (21.4% of RFLP seq)-
SGN-U1441083.5e-2354 (13.4% of RFLP seq)-
SGN-U144109325 (80.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53442)
Chromosome
10
Position
30.48 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51860)
Chromosome
10
Position
55.75 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43631)
Chromosome
10
Position
39.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43493)
Chromosome
10
Position
34.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43031)
Chromosome
10
Position
35.40 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Pepper Capsicum   
Map version
65 (location: 42698)
Chromosome
10
Position
55.60 cM
Confidence
uncalculated
Protocol
RFLP


Pepper Capsicum

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40729)
Chromosome
10
Position
33.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8287)
Chromosome
10
Position
33.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8288)
Chromosome
10
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT11 was used as an overgo probe on plate 15 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTTGCAGAACCGTGGGCCAATAG
B sequence
ACACCACAACAGCCTCCTATTGGC
AB sequence
ATTTGCAGAACCGTGGGCCAATAGGAGGCT
Marker sequence
CCAAGATTGCTTGTTTGGTGGTTTTATGCATGTTGATTACAAATGCACCC
CATGCAAAGGCAGTGACTTGTGGCCAAATTCAGGTTGGGGTAGTGAATTG
CCTTCCTTATTTGCAGAACCGTGGGCCAATAGGAGGCTGTTGTGGTGTCA
TTAAAGATTTGCTTAAGCTTTGTAAGACACCACATGAACGTAGAAAATCA
TGTAAGTGTGTCAAAAAAGCTGCTAATACTATTAAAGGCATTGATTTTGG
TAAAGCTGCTGGTCTTTCTGGAGTTTGTGGTGTCAAGATTCCTTTTGAGA
TCAGCCCCTCTGTTGACTGCTCCAAGTATGTTTTCAGTTATCGGTTGACC
TAATTTAATCTTAAAAGCTGAATATTTAATGTGTCTTTGGTAAAAAAAAA
AA
Genomic location of CT11  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D142 marker 142
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)