SGN Marker T0386

SGN-M1423
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TOVAU45TH
Arabidopsis best BAC match: AC006929.3
Arabidopsis position: 2.1580000
Arabidopsis identities: 0.835
Best GenBank protein hit: AAA87731.1
Evalue: 7.3e-63
Identities: 0.911
Description: alphacpn60 [Pisum sativum]
Comment: plant chloroplast chaperonin 60
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39338)
Chromosome
11
Position
85.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39339)
Chromosome
6
Position
76.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39340)
Chromosome
1
Position
48.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0386 was used as an overgo probe on plate 3 [well A1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P072K10,   P258M23,   P002L01,   P268A20

 Overgo Sequences

A sequence
TGAGTACCAGGCAACTGATTTGGG
B sequence
ATTCTCAACGAGCAGGCCCAAATC
AB sequence
TGAGTACCAGGCAACTGATTTGGGCCTGCT
Marker sequence
GCCGAGGATATCACCGGGGAAGCTCTGGCCACTCTTGTTGTGAACAAGTT
GCGAGGTATACTGAATGTTGCTGCCATCAAAGCTCCTGGATTTGGTGAAA
GGAGAAAGGCTCTTCTGCAAGATATTGCCATTGTGACAGGAGCTGAGTAC
CAGGCAACTGATTTGGGCCTGCTCGTTGAGAATACCCCAGTTGAAGCACT
TGGAATTGCCAGAAAGGTGACAATTACCAAGGACTCAACAACCATCATCG
CTGATGCAGCATCAAAGGACGAGATACAATCTAGGATTGCTCAGCTTAAA
AAGGAACTGTCTGAGACAGATTCAGTGTACGACTCCGAGAAACTTGCTGA
GAGAATTGCCAAGCTTTCTGGGGGTGTCGCCGTCATTAAGGTTGGAGCTG
CAACAGAGGCCCGAGCTTGAAGACC
Genomic location of T0386  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1423 marker 1423
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)