SGN Marker T0393

SGN-M1424
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TOVBB82TH
Arabidopsis best BAC match: AC009325.6
Arabidopsis position: 3.0030000
Arabidopsis identities: 0.821
Best GenBank protein hit: BAB01250.1
Evalue: 2.7e-72
Identities: 0.813
Description: kinase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39341)
Chromosome
9
Position
70.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0393 was used as an overgo probe on plate 14 [well H10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAAGACATGACCGGAGAAACCGGA
B sequence
CCATGTATCCAAGGGTTCCGGTTT
AB sequence
AAAGACATGACCGGAGAAACCGGAACCCTT
Marker sequence
GATTGTACATCGTGATGTGAAAGCTGAAAATATGTTGATAGATACTAGTA
GAAATTTAAAAATTGCTGATTTTGGAGTTGCTCGTGTTGAAGCACAAAAT
CCCAAAGACATGACCGGAGAAACCGGAACCCTTGGATACATGGCCCCAGA
GGTACTTGATGGCAAGCCTTACAACAGAAAATGTGATGTATATAGCTTCG
GTATTTGCTTATGGGAAATTTATTGCTGTGATCTCCCATATCTAGATCTA
AGCTTCGCTGAAGTCTCTTCTGCCGTTGTTAGACAGAATTTGCGACCAAA
TCTCCCGAAATGTTGTCCAAGCTCTGTATCAAATATCATGAAGAAATGCT
GGGACGCAAATCCAGACAAACGACCTGAAATGGATGAGGTAGTGAAAATG
TTGGAAGTCATTGTCACAGACAAAGGAGGATGAATGATACCCTCAGATCA
AGTTGTACAAGGCT
Genomic location of T0393  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1424 marker 1424
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)