SGN Marker T0405

SGN-M1425
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 3.25
Tomato EST read: TOVCI09TH
Arabidopsis best BAC match: AC007290.5
Arabidopsis position: 2.1540000
Arabidopsis identities: 0.909
Best GenBank protein hit: AAD26882.2
Evalue: 5.0e-39
Identities: 0.919
Description: "putative chromosome associated protein [Arabidopsis thaliana]/ e-25, SMCD [Mus musculus]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49510)
Chromosome
6
Position
41.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47444)
Chromosome
6
Position
75.85 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39828)
Chromosome
6
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0405 was used as an overgo probe on plate 4 [well E1]

Plausible BAC Matches:   P244H10,   P110G14,   P055E14,   P011E22

 Overgo Sequences

A sequence
AGTGAAGGTGTCGTTCACTGGACA
B sequence
TGGCTGTGTTTCTCCTTGTCCAGT
AB sequence
AGTGAAGGTGTCGTTCACTGGACAAGGAGA
Marker sequence
AGGATGGTGAGGAAGATGACAATGATCCTGATGATGATGAGCCGCGTGCT
GATGCAGAGGGAAGAGTTGAGAAATATATTGGTGTGAAAGTGAAGGTGTC
GTTCACTGGACAAGGAGAAACACAGCCAATGAAACAGTTATCAGGGGGCC
AGAAAACTGTGGTAGCACTGGCACTTATATTTGCCATACAAAGATGTGAT
CCTGCCCCATTTTATCTTTTTGATGAGATAGATGCAGCACTAGATCCTCA
GTACAGAACAGCCGTGGGGAATATGGTTCGTGATTTGGCAGACAGGGGTA
GCACGCAATTTATCACGACGACATTT
Genomic location of T0405  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1425 marker 1425
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)