SGN Marker T0418

SGN-M1427
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVCW45TH
Arabidopsis best BAC match: AB022214.1
Arabidopsis position: 5.2220000
Arabidopsis identities: 0.803
Best GenBank protein hit: BAB09934.1
Evalue: 1.7e-46
Identities: 0.805
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39343)
Chromosome
10
Position
1.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0418 was used as an overgo probe on plate 1 [well C8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGGTGCTTTTGCTTCTCCAGTTC
B sequence
TTGGTTCCTGCAGCTTGAACTGGA
AB sequence
CTGGTGCTTTTGCTTCTCCAGTTCAAGCTG
Marker sequence
GCACGAGGAGAAATTAAGGAGAGAGAAACTGAATGAAAAGTTCATGGAAT
TGGCGGTGCTTCTTGAGCCCAGCAGGCCTCCAAAAACAGACAAGAGTGCC
ATTCTTGTTGATGCTGTTCGCGTGGTGACACAGTTACGTGGTGAGGCTCA
AAAATTGAAAGACTCAAATTTGGATCTACAAGAAAAGATAAAGGAGTTGA
AGGTTGAGAAAAATGAGCTTCGAGATGAAAAGCAGAGGCTGAAGTCCGAG
AAAGAGAAGCTAGAGCAACAACTAAAGACTATGAGTGCACAACCTAGCTT
CCTGCCTCCTGCCATGCCTGGTGCTTTTGCTTCTCCAGTTCAAGCTGCAG
GAACCAAGCTGGTGCCAATCATAAGTTACCCTGGAGTTGCCATGTGGCAA
TTCATGCCTCCTGCTGCAATAGATACCTCGCAGGATCACGTGCTCCGCCC
TCCAGTTGCTTAAATTTGCTGCTAAAACCTATGATAATT
Genomic location of T0418  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1427 marker 1427
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)