SGN Marker T0431

SGN-M1434
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVDN76TH
Arabidopsis best BAC match: AC003027.1
Arabidopsis position: 1.0070000
Arabidopsis identities: 0.716
Best GenBank protein hit: AAD10668.1
Evalue: 9.3e-24
Identities: 0.650
Description: unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49512)
Chromosome
9
Position
60.82 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47446)
Chromosome
9
Position
55.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42390)
Chromosome
9
Position
60.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39829)
Chromosome
9
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10540)
Chromosome
9
Position
64.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0431 was used as an overgo probe on plate 7 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAGGACTGCTATTGGGATTACGG
B sequence
TGCACATCGAGCTTTCCCGTAATC
AB sequence
TGAGGACTGCTATTGGGATTACGGGAAAGC
Marker sequence
CTGGGGCCAAAAGTGAACATAACAAGGACACCACAGTCAGAGCATGATGG
TTCAGATGTACAAGTGCATCTAAATATAGAGCATCAACATGGTGAAGATA
TCATTCCCAATATGACAAAGTTACCTACAATGAAGTACATAACCTATTAT
GAGGATTCTGAAAGTTTTCCAGGGACAAGAACAGCAGTTTGGGAGCTTGA
TAAAGCAAATCACAGGAACATTGTCAGATCTCCAGCTTTGATGCGGGAGC
TGTGGCTTGAGATGTGGCATGATATTCATCCTGATAAAAAGTCCAAGTTT
GTTACAAAAGGTGGTGTCTGATCCTCACTATTTTCTTCTATAAATGTTTG
AGTTTGTATTGACATTGTAAGTATTGCAACAAAAAGCAAAGCGTGGGCCT
CTGAGGGATGAGGACTGCTATTGGGATTACGGGAAAGCTCGATGTGCATG
GGCTGAACATTGTGAATACAGGTTAGAATATTCAAATTATATTTTG
Genomic location of T0431  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1434 marker 1434
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)