SGN Marker T0443

SGN-M1435
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.1
Tomato EST read: TPRAC34TH
Arabidopsis best BAC match: AC007109.6
Arabidopsis position: 2.1180000
Arabidopsis identities: 0.907
Best GenBank protein hit: AAD25643.2
Evalue: 3.6e-65
Identities: 0.932
Description: succinyl-CoA ligase beta subunit [Arabidopsis thaliana]
Comment: succinyl-CoA synthetase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39344)
Chromosome
9
Position
50.20 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39345)
Chromosome
6
Position
97.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0443 was used as an overgo probe on plate 2 [well F9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P222K05,   P253G13,   P299P05

 Overgo Sequences

A sequence
GCATGGTAAATGGTGCTGGATTGG
B sequence
TCCATGGTAGCCATTGCCAATCCA
AB sequence
GCATGGTAAATGGTGCTGGATTGGCAATGG
Marker sequence
GCCGATTTGAATTATATTGGCTTGGATGGAGAAATTGGTTGCATGGTAAA
TGGTGCTGGATTGGCAATGGCTACCATGGATATTATTAAGCTTCATGGGG
GAACTCCAGCCAATTTTCTAGATGTTGGTGGAAATGCTACTGAAGGCCAG
GTTGTCGAGGCCTTCAAAATTTTGACTGCAGATGAGAAGGTGAAAGCTAT
TTTGGTGAACATCTTTGGCGGAATAATGAAGTGTGATGTGATAGCCAGTG
GTATTGTTAATGCAGCCAAGCAGGTTCAACTGAAAGTACCTGTGATTGTT
CGTCTGGAAGGAACCAACGTCGAACAAGGGAAGAGAATTCTCAAGGAAAG
TGGCATGAAACTGATTACCGCTGAGGATTTAGATGACGCACCTGAAAAGG
CA
Genomic location of T0443  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1435 marker 1435
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)