SGN Marker TG608

SGN-M144

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG608 image not available
Forward sequence
AGTTTGTTTGCCATAGGTAAGTGGTCTCTCTTACCTACTGACACTGAAATAGCACATGTATTTTTGAGAGCCTACATGGTAACAACTCAT
CTGCATCCAGAATTTGTTGTACTTTCTCCTAAATTATGCAAATAGCAGCTCGAGCTATGCAAGTTCAATCCCATATTTGGTTGCTCTACC
ATCTTTTTTCAATTGCAGGAATCCCAGGTGCCTTTACTTTGTTTTACATATATGAAAAGAAAGAGGAAGAAATAGATCATGTACTTCAAG
ATATTGTCTTATTTACATGGAAGTTGAAGTCTGATATTTCTGGGAAAATTTTCAGCTCTACAAAAAAGGACCGATAATAGACAGCAAATT
ACCTGTTCAAACTTCTTCCTTATCTTGAGAAGCTTTCTTAAGCAGGTTGTTGAAGTTCAAGGACTTCACACTTATCCTTGTGTGTAACAT
ATTAATGGGAACCTTGCTGAAAGCC
Reverse sequence
CTATAGTTTTGCTGGCTCAAAATTAGAATAGTTACTTGTAAATGAATAAAAAATCCATGAAAAATGTTAAAATTTAGTGAGTGATGTTCA
CTAGAATATCATACGAACTTCAAAATTCCAAATTCCTAAAATATGAACAAGAAAATAAGAGAAAATGTTCATTAGAGTAGTGTACGAAGA
ACTTTACTGGTCTTAATAAATAATAAGGAATAGTAATCTCGAATTAAAATGTAAAATTATTTTATCCTATTTTTGTTTAGGAGTTTTAGT
TAGTTTCAGAATTGTTTATCCTATCAACCTGTATGTGTATATATGGAATAACTACTCTCATGAGATATCTCAATTCATTGAATAATGAAA
TGAATAAATCTTCTCAAACGAAAATAATATTGACAAACTAAACTTTTAACGAATGATGAGTTTTTCTCATTAGTGTTAGGCAAGTGGAAG
AAGAAGAAAATAAAAATAAAAATGAAATTTTAAGTGGATATTTTTCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1569512e-157279 (58.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53574)
Chromosome
2
Position
1.44 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43884)
Chromosome
2
Position
45.00 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43623)
Chromosome
2
Position
1.60 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43346)
Chromosome
2
Position
12.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40891)
Chromosome
2
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36591
Forward primer (5'-3')
TCCCAGGTGCCTTTACTTTG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTTGCTGGCTCAAAATTAGAA
Digested band sizes (using BsaHI)
Solanum pennellii TA56
1600
Solanum lycopersicum TA209
900
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8296)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8297)
Chromosome
2
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG608 was used as an overgo probe on plate 15 [well H6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCTCGAGCTATGCAAGTTCAATC
B sequence
GAGCAACCAAATATGGGATTGAAC
AB sequence
AGCTCGAGCTATGCAAGTTCAATCCCATAT
Marker sequence
AGTTTGTTTGCCATAGGTAAGTGGTCTCTCTTACCTACTGACACTGAAAT
AGCACATGTATTTTTGAGAGCCTACATGGTAACAACTCATCTGCATCCAG
AATTTGTTGTACTTTCTCCTAAATTATGCAAATAGCAGCTCGAGCTATGC
AAGTTCAATCCCATATTTGGTTGCTCTACCATCTTTTTTCAATTGCAGGA
ATCCCAGGTGCCTTTACTTTGTTTTACATATATGAAAAGAAAGAGGAAGA
AATAGATCATGTACTTCAAGATATTGTCTTATTTACATGGAAGTTGAAGT
CTGATATTTCTGGGAAAATTTTCAGCTCTACAAAAAAGGACCGATAATAG
ACAGCAAATTACCTGTTCAAACTTCTTCCTTATCTTGAGAAGCTTTCTTA
AGCAGGTTGTTGAAGTTCAAGGACTTCACACTTATCCTTGTGTGTAACAT
ATTAATGGGAACCTTGCTGAAAGCC
Genomic location of TG608  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D144 marker 144
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)