SGN Marker T0486

SGN-M1440
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TCAAZ16TH
Arabidopsis best BAC match: AC007354.2
Arabidopsis position: 1.0320000
Arabidopsis identities: 0.753
Best GenBank protein hit: CAA39708.1
Evalue: 3.4e-63
Identities: 0.788
Description: auxin-induced protein [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39347)
Chromosome
9
Position
109.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0486 was used as an overgo probe on plate 14 [well D10]

Plausible BAC Matches:   P226D21,   P310L18

 Overgo Sequences

A sequence
CAAGGACTTGGTTGTCTGGGTATG
B sequence
GACCGTAGAAATCGGACATACCCA
AB sequence
CAAGGACTTGGTTGTCTGGGTATGTCCGAT
Marker sequence
CAATGACGAAAGAGGGAAAGAATGTGAAAAGAATCAAATTGGGTTCAGAG
GGACTTGAAGTATCTGTTCAAGGACTTGGTTGTCTGGGTATGTCCGATTT
CTACGGTCCGCCCAAACCCGAACCCGATATGATTGAACTAATACACCATG
CCATTAACTCCGGCATAACATTTTTCGATACTTCAAATAGTTATGGGCCT
TACACTAATGAAATCCTCCTTGGCAAGGCTTTGAAGGGAGGAATGAGGGA
ACGAGTCGAGTTAGCAACAAAATTTGGTATACATTTTGCAGATGGAAAGA
TAGAAGTACGTGGAGAGCCATAATATGTAAGGGCAGCATGCGAGGCTAGC
TTAAAGCGACTTGATGTTGATTGCATAGACTTGTACTACCAGCACCGGAT
TGATACACGCGTGCCCATTGAAGTAACGGTTGGAGAACTTAA
Genomic location of T0486  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1440 marker 1440
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)